The NADPH oxidase OsRbohA increases salt tolerance by modulating K+homeostasis in rice

Qingwen Wng,Ln Ni,Zhenzhen Cui,Jingjing Jing,Cho Chen,Mingyi Jing,b,*

a National Key Laboratory of Crop Genetics and Germplasm Enhancement/Key Laboratory of Crop Physiology Ecology and Production Management,Ministry of Agriculture/College of Life Sciences,Nanjing Agricultural University,Nanjing 210095,Jiangsu,China

b Southern Regional Collaborative Innovation Center for Grain and Oil Crops in China,Hunan Agricultural University,Changsha 410128,Hunan,China

Keywords:Rice OsRbohA H2O2 K+homeostasis Salt tolerance

ABSTRACT Rice(Oryza sativa L.)is a staple cereal for more than two thirds of the world’s population.Soil salinity severely limits rice growth,development,and grain yield.It is desirable to elucidate the mechanism of rice’s salt-stress response.As the major source of H2O2,NADPH oxidase(Rboh)is believed to be involved in salt-stress tolerance.However,the function and mechanism of rice Rboh in salt stress response remain unclear.In this study,we found that the expression of OsRbohA was up-regulated by NaCl treatment in the shoots and roots of rice seedlings.Knockout of OsRbohA reduced the tolerance of rice to salt stress.Knockout of OsRbohA blocked NaCl-induced increases of NADPH activity and H2O2 content in roots.OsRbohA knockout inhibited root growth and disrupted K+homeostasis by reducing the expression of K+transporters and channel-associated genes(OsGORK,OsAKT1,OsHAK1,and OsHAK5)in roots under NaCl treatment.Under NaCl treatment,OsRbohA knockout also reduced subcellular K+contents of the plasma membrane and soluble fraction.Overexpression of OsRbohA increased the expression of K+transporters and channel-associated genes and reduced the loss of K+ions in roots.These results indicate that OsRbohA-mediated H2O2 accumulation modulates K+homeostasis,thereby increasing salt tolerance in rice.

1.Introduction

Soil salinity,which is increasing worldwide,severely impairs the germination,growth,quality,and productivity of crop plants[1,2].Rice(Oryza sativa L.)is a staple crop that is highly sensitive to salt stress[3,4].It is desirable to increase its tolerance to salt stress.To adapt to salt stress,plants have developed a variety of physiological and biochemical strategies,including reestablishing the balance of reactive oxygen species(ROS)and maintaining ion and osmotic homeostasis[1,5].Many saltresponsive signaling protein kinases,transcription factors,and their interaction networks have been revealed[6].Most functional analyses of salt stress have been performed at the whole-plant level,and only a few studies have focused on tissue and/or cellspecific expression in rice[7-9].Studies of the evolution of plant salinity tolerance have shown that halophytes can regulate NADPH oxidase activity,resulting in more efficient ROS signaling and adaptation to saline conditions[10].

ROS include the superoxide anion(O2·-),hydroxyl radical(OH),hydrogen peroxide(H2O2),and singlet oxygen(1O2)[11].Although high concentrations of ROS are harmful,causing oxidative damage to cellular constituents in plants,lower concentrations of ROS have been considered[12,13]to act as second messengers in salt stress response,causing various stress responses and hormone signal transduction as well as regulating transcriptional processes.

ROS can be produced by multiple sources in plants,among them plasma membrane NADPH oxidase[14].NADPH oxidases encoded by respiratory burst oxidase homolog(Rboh)genes are homologous to the mammalian NADPH oxidase catalytic subunit gp91Phox[15],contain an extra N-terminal extension region containing two elongation factor(EF)hand motifs for binding Ca2+,and directly use Ca2+to regulate oxidase activity[16].Many members of the Rboh family have been identified in plants including rice[17],Arabidopsis[18],tomato[19],tobacco[20],potato[21],and maize[22].Rbohs have been reported to regulate plant growth and development,such as polar growth of root hairs[22],pollen development[23,24],programmed cell death[23],stomatal closure[25],and seed after-ripening[26].

The function of Rbohs under environmental stresses is a hot topic in current research[27-29].AtRbohI participates in plant drought stress response[30].Both AtRbohD and AtRbohF function in regulating plant disease resistance,cell death,and ABA-induced stomatal closure[18,31].Wang et al.[32]showed that AtRbohB and AtRbohD acted as the main synthetases in heat stress by inducing H2O2.All these reports suggest that ROS act as highly controlled signaling molecules functioning in plant response to stress conditions.Growing evidence suggests that Rbohs also play a vital role in regulating response to salt stress[33,34].Knockout of AtRbohD or AtRbohF in Arabidopsis increased salt sensitivity[33,35].A soybean Rhoh gene,GmRbohBs,functioned in regulating root growth under salt stress[36].In a very recent study[37],silencing of tobacco NtRbohE resulted in salt hypersensitivity.However,the function of rice Rboh in salt stress response is still unclear.

In this study,we first measured the expression of OsRbohA in both shoots and roots of rice seedlings under NaCl treatment.Then we measured NADPH oxidase activity and H2O2content in osrboha mutant exposed to salt stress,Na+/K+content and fluxes,and the expression of genes encoding K+transporters and channels in an osrboha mutant and OsRbohA-overexpressing line exposed to salt stress.We describe a mechanism by which OsRbohA modulates K+homeostasis by affecting H2O2accumulation,thus positively regulating the tolerance of rice plants to salt stress.

2.Materials and methods

2.1.Plant materials and growth conditions

The accessions used in this study included the O.sativa japonica cv.Nipponbare(WT),OsRbohA knockout(KO)lines,and OsRbohAoverexpressing(OE)lines.Plants were grown in Hoagland’s nutrient solution at 28 °C/24 °C(day/night)under a 14 h/10 h photoperiod.

2.2.Generation and identification of homozygous mutant plants

The OsRbohA-OE lines were described previously[38].The osrboha-KO mutant plants were generated using CRISPR/Cas9 system[39]editing of Nipponbare by Biogle Biotechnology(Changzhou,Jiangsu,China).To identify the genotype of the osrboha-KO mutant,genomic DNA was extracted from the leaves as the template for PCR.The target site was AGCTGTTCGACACGCTGAGCCGG and the DNA was amplified with the primers described in Table S1.Positive transgenic plants were identified by PCR and sequencing.Two osrboha homozygous T2lines(KO1 and KO2)were obtained for subsequent experiments.

2.3.Detection of H2O2 content and NADPH oxidase activity

Detection and quantification of H2O2production in shoots and roots of WT and osrboha mutants were performed as described previously[40].Leaves from rice seedlings were stained with 3,3′-diaminobenzidine(DAB).H2O2contents were determined with a Hydrogen Peroxide Assay Kit(Beyotime Institute of Biotechnology,Shanghai,China)following the manufacturer’s instructions.

NADPH oxidase activity was measured as described by Duan et al.[41]with some modifications,assaying NADPH-dependentgeneration in isolated plasma membrane vesicles.The reduction of sodium 3′-[1-[phenylamino-carbonyl]-3,4-tetrazolium]-bis(4-methoxy-6-nitro)benzenesulfonic acid hydrate(XTT)was used to quantify NADPH oxidase activity.

2.4.Phenotype analysis

To observe seedling growth phenotypes,10-day-old seedlings were transferred to hydroponic culture containing 100 mmol L-1NaCl for 10 days.After recovery by re-watering for 7 days,the surviving seedlings were counted and photographed.For root growth phenotype,three-day-old seedlings with the same root length(～1 cm)were transferred to hydroponic culture solution containing 50 mmol L-1or 100 mmol L-1NaCl.After 7 days treatment,photographs were taken,and root length and fresh weight were recorded.For the seed germination phenotype,WT and osrboha seeds were sprayed with solutions containing 50 or 100 mmol L-1NaCl,and germination rates were recorded daily.After 9 days of treatment,photographs were taken.

2.5.Detection of oxidative damage and chlorophyll content

For measurement of oxidative damage,10-day-old seedlings were immersed in water solution with or without 100 mmol L-1NaCl for 2 days.Malondialdehyde(MDA)content was measured as described by Wang et al.[42]with some modifications.Fresh leaf samples were homogenized at 4°C in 10%(w/v)trichloroacetic acid,after which the supernatant was mixed with 0.6% thiobarbituric acid and heated at 100 °C for 15 min.Sample absorbance at 450,532,and 600 nm was recorded.MDA content was obtained as MDA(nmol g-1)=6.45×(A532-A600)-0.56×A450.The proportion of electrolyte leakage was measured following Han et al.[43].The total chlorophyll content was measured following Yan et al.[44].

2.6.Measurement of fresh weight,dry weight,and relative water content

Ten-day-old seedlings were cultivated in water solution with or without 100 mmol L-1NaCl for 10 days.After treatment,fresh seedling weight was recorded.Seedlings were then dried at 80 °C to constant weight and dry weight was recorded.Relative water content was measured following Han et al.[43].

2.7.Chlorophyll fluorescence

Chlorophyll fluorescence parameters were measured with the MAXI version of the IMAGE-PAM chlorophyll fluorescence system(Walz,Effeltrich,Germany)following the manufacturer’s instructions and Jiao et al.[45].Leaves were measured after dark adaptation for 30 min at room temperature to calculate PSII maximal photochemical efficiency(Fv/Fm),the trend of the quantum yield of PSII photochemistry(ΦPSII),the coefficient of photochemical quenching(qP),the trend of the yield for other energy losses(Y(NO)),the quantum yield of regulated energy dissipation in PSII(Y(NPQ)),and the rate of photosynthetic electron transport through PSII(ETR).

2.8.Measurement of Na+content and K+content in roots

After 10 days of 100 mmol L-1NaCl treatment,rice roots were killed by heating at 100 °C for 30 min and then dried at 80 °C to constant weight.The dried samples were weighed(15-20 mg)and digested with 800μL nitric acid at 90°C for 8 h[46].The subcellular fractions of rice roots were separated following Jabeen et al.[47]and Zhang et al.[48].Different speeds were used to separate organelles:1500×g for the plastid fraction,5000×g for the nucleus fraction,15,000×g for the mitochondria fraction,and 50,000×g for the plasma membrane,and the final supernatant represented the soluble fraction of the root cell.Every subcellular fraction was dried.The contents of Na+and K+were measured by inductively coupled plasma-optical emission spectrometry(Optima 2100 DV,Perkin Elmer,Shelton,CT,USA).

Fig.1.Expression of OsRbohA,NADPH oxidase activity,and H2O2 content under NaCl treatment and tissue-specific expression of OsRbohA during rice development.(A,B)Relative expression levels of OsRbohA in shoots and roots of rice seedlings exposed to salt stress.(C,D)NADPH oxidase activity in shoots and roots of rice seedlings exposed to salt stress.(E,F)H2O2 content in shoots and roots of rice seedlings exposed to salt stress.Ten-day-old seedlings of wild type(WT)were treated with 100 or 200 mmol L-1 NaCl for the indicated times and OsRbohA expression,NADPH oxidase activity,and H2O2 content were determined.(G)Tissue-specific expression patterns of OsRbohA during rice development.Fourteen-day-old seedlings and fourteen-week-old seedlings of WT were collected.OsRbohA expression was measured.Values are means±SD(n=3).Means labeled with different letters in(A-F)are different(P≤0.05).

2.9.Ion flux measurements

Net fluxes of Na+and K+were measured using noninvasive micro-test technology(NMT,Younger USA,Amherst,MA,USA)[49-51].Three-day-old seedlings were treated with 100 mmol L-1NaCl for 24 h.Before flux measurements,the ion-selective microelectrodes for the target ions were calibrated,and Nernstian slopes＞52 mV were used for Na+and K+.Na+and K+fluxes were measured at the primary root meristem zone(～500μm from the root tip).

2.10.Real-time PCR

Total RNA was extracted with the RNAiso Plus kit(TaKaRa Bio,Tokyo,Japan)from shoots and roots following the manufacturer’s instructions and Ni et al.[39].Total RNA was reverse-transcribed using a PrimeScript RT reagent Kit with gDNA Eraser(TaKaRa Bio).The cDNA was amplified by PCR using the specific primers listed in Table S1.The rice glyceraldehyde-3-phosphate dehydrogenase(GAPDH)gene was used as internal control.Relative expression levels were determined using the 2-△△CTmethod[52].

3.Results

3.1.NaCl treatment up-regulated OsRbohA expression,NADPH oxidase activity,and H2O2 content

To investigate the role of OsRbohA in plant salt stress response,the expression of OsRbohA in shoots and roots under NaCl treatment was quantified by quantitative real-time PCR.As shown in Fig.1A and B,expression of OsRbohA increased in both shoots and roots under 100 or 200 mmol L-1NaCl treatment.In shoots,the highest level of OsRbohA expression was at 6 h(Fig.1A).However,the number of OsRbohA transcripts in roots reached the maximum at 1 h(Fig.1B).NADPH oxidase is considered[53]to be an important producer of ROS.In agreement with OsRbohA expression,NADPH oxidase activity and H2O2content in both shoots and roots were up-regulated by NaCl treatment(Fig.1C-F).These results suggest that OsRbohA may be involved in salt-stress response in rice.

Tissue-specific expression of OsRbohA was measured at several rice developmental stages.The expression of OsRbohA exhibited tissue specificity at some stages(Fig.1G).Compared with the level in seeds,expression of OsRbohA was markedly higher in roots and leaves at the seedling and heading stages and also in stem and pistil at the heading stage,but lower in stamens at the heading stage.The amino acid sequence of OsRbohA protein in rice was aligned with those of Rbohs proteins regulated by salt stress in other plant species[35-37](Fig.S1).The protein sequence of OsRbohA showed approximately 63% identity with those of AtRbohD,AtRbohF,NtRbohE,and GmRbohB.The FAD-binding domain,EF-hands,and C-terminal protein sequence were highly conserved in these Rbohs(Fig.S1B).

3.2.OsRbohA increased salt tolerance in rice plants

To further confirm the role of OsRbohA in salt stress,we obtained two lines of the osrboha knockout mutant(KO1 and KO2)generated with the CRISPR/Cas9 system(Fig.S2).Eighteen osrboha knockout mutants were screened by PCR to identify hygromycin-resistance genes(Fig.S2B).Two homozygous lines were obtained by sequencing(Fig.S2C),in which the amino acid translation of KO1 line was frameshift mutation and the amino acid translation of KO2 line was terminated(Fig.S2D).Other genes of the Rboh family,OsRbohB/C/D/E/F/G/H/I,were identified as free of mutations in osrboha knockout mutants(Fig.S3),showing that there were no off-target effects in the other Rboh genes of the Rboh family.

Fig.2.OsRbohA increases salt-stress tolerance in rice.(A)Phenotype of osrboha mutants(KO1 and KO2)and wild type(WT)under salt stress.Ten-day-old seedlings were treated with 100 mmol L-1 NaCl for 10 days and then recovered by re-watering for 7 days.Scale bar,5 cm.(B)Survival rates(%)in(A).The experiment was repeated at least three times and approximately 50 plants of each transgenic line were tested for survival rate in each treatment.(C)Chlorophyll content,(D)malondialdehyde(MDA)content,and(E)percent leakage of electrolyte in leaves of osrboha mutants and WT plants under NaCl treatment.Ten-day-old seedlings were treated with or without 100 mmol L-1 NaCl for 2 days,after which the above physiological indexes in shoots of osrboha mutants and WT seedlings were recorded.Values are means±SD(n=3).Asterisks in(B-E)indicate significant differences compared with the corresponding WT plants at the same time point(*,P≤0.05;**,P≤0.01).

Ten-day-old seedlings of osrboha mutants(KO1 and KO2)and wild type(WT)were treated with 100 mmol L-1NaCl for 10 days.Under non-NaCl treated conditions,there were no morphological differences between osrboha and WT in the growth of seedlings.Under the NaCl treatment,the osrboha mutants showed higher chlorosis and growth inhibition than WT plants(Fig.2A).After recovery for 7 days,the survival rates of the osrboha lines were lower than that of the WT(Fig.2B).The content of chlorophyll in osrboha mutants was significantly lower than that in WT plants under NaCl stress(Fig.2C).Under NaCl stress,osrboha mutants showed higher oxidative damage than WT plants(Fig.2D,E).The MDA contents of osrboha KO1 and KO2 were respectively～29%and～33%higher than that of the WT(Fig.2D),and their electrolyte leakage levels were～46% and～44% higher than that of the WT(Fig.2E).Under NaCl stress,fresh weight and dry weight were significantly decreased in osrboha mutant plants relative to those in WT plants(Fig.S4A,B).A greater reduction in relative water content was also observed in osrboha mutant plants under NaCl stress than in WT plants(Fig.S4C).These results suggest that OsRbohA positively regulates salt tolerance in rice.

3.3.OsRbohA increased photosynthetic capacity in rice plants under salt stress

Under 100 mmol L-1NaCl treatment,the maximal photochemical efficiency of PSII(Fv/Fm)was significantly decreased in osrboha mutant plants,compared with that in WT plants(Fig.3A).A significant decrease in the effective quantum yield of PSII photochemistry(ΦPSII)(Fig.3B),the coefficient of photochemical quenching(qP)(Fig.3C),and the rate of photosynthetic electron transport through PSII(ETR)(Fig.3F)was also observed in the osrboha mutant plants under NaCl stress,compared with those in the WT plants.By contrast,the trend of the yield for other energy losses with the increase of light intensity(Y(NO))(Fig.3D)and the quantum yield of regulated energy dissipation in PSII(Y(NPQ))(Fig.3E)were significantly increased in osrboha mutant plants relative to WT plants.Thus,knockout of OsRbohA aggravated the photosynthetic capacity damage under salt stress.

3.4.Mutation of OsRbohA reduced NADPH oxidase activity and H2O2 content in rice plants under salt stress

To determine whether OsRbohA was associated with the increase of NADPH oxidase activity and H2O2content under salt stress,NADPH oxidase activity and H2O2content in osrboha mutants were measured.DAB staining results showed that the accumulation of H2O2in osrboha mutant plants was significantly decreased relative that of WT plants under salt stress(Fig.4A).Knockout of OsRbohA inhibited NaCl-induced increases in the activity of NADPH oxidase(Fig.4B,D)and the content of H2O2(Fig.4C,E)in both shoots and roots of rice plants,and the inhibition of NADPH oxidase activity and H2O2content were greater in roots than in shoots.Thus,OsRbohA was involved in regulation of NADPH oxidase activity and H2O2content under salt stress.

3.5.OsRbohA was required for seed germination under salt stress

Fig.3.OsRbohA increased photosynthetic capacity under salt stress.(A)Fv/Fm,(B)ΦPSII,(C)qP,(D)Y(NO),(E)Y(NPQ),and(F)ETR of osrboha mutants and WT seedlings exposed to salt stress.Ten-day-old seedlings were treated with or without 100 mmol L-1 NaCl for 2 days,after which the above indexes in the leaves of osrboha mutants and WT seedlings were recorded.Values are means±SD(n=3).Means labeled with different letters in(A-F)are different(P≤0.05).

To determine whether OsRbohA functions in seed germination under salt stress,we performed a direct analysis of the seed germination phenotype in osrboha mutants.Under the nontreated conditions,there was no visible difference in seed germination between osrboha and WT plants(Fig.S5).Under the NaCl treatment conditions,seed germination in WT and osrboha was markedly reduced,and a lower level of seed germination was observed in osrboha mutants than in WT(Fig.S5).Thus,OsRbohA positively regulated rice seed germination under salt stress.

Fig.4.OsRbohA regulates NADPH oxidase activity and H2O2 content under salt stress.(A)DAB staining in leaves of osrboha mutants and WT seedlings exposed to salt stress for 6 h.Scale bar,1 mm.(B,D)NADPH oxidase activity in shoots and roots of osrboha mutants and WT seedlings exposed to salt stress for the indicated times.(C,E)The H2O2 content in shoots and roots of osrboha mutants and WT seedlings exposed to salt stress for the indicated times.Values are means±SD(n=3).Asterisks in(B-E)indicate significant differences from the corresponding WT plants at the same time point(*,P≤0.05;**,P≤0.01).

3.6.OsRbohA was required for root growth under salt stress

To clarify the significance of OsRbohA in maintaining root development of rice plants under salt stress,we performed a direct analysis of the root phenotype.Under nontreated conditions,there was no visible difference in root phenotype between osrboha plants and WT plants(Fig.S6A).NaCl treatment markedly inhibited root growth in WT plants(Fig.S6A),and the NaCl sensitivity of both root length(Fig.S6B)and fresh weight(Fig.S6C)was increased in osrboha plants,indicating that OsRbohA conferred salt tolerance in root growth.

3.7.OsRbohA regulated K+homeostasis in roots under salt stress

A previous study[54]showed that salt stress resulted in high Na+concentrations,low K+concentrations,and high ratios of Na+to K+in plants.To further investigate whether OsRbohAmediated salt stress tolerance is dependent on ion homeostasis,Na+and K+contents were measured in the roots of WT and osrboha mutants.In the absence of NaCl treatment,there were no significant differences between osrboha and WT plants in contents of Na+(Fig.5A)and K+(Fig.5B),and ratio of Na+to K+(Fig.5C)in roots.In the presence of NaCl,the content of K+in the roots of WT and osrboha was markedly reduced(Fig.5B),and lower K+content was observed in roots of osrboha mutants than in WT(Fig.5B).However,there was no difference in root Na+content between osrboha mutants and WT plants exposed to salt stress(Fig.5A).Na+/K+ratios in osrboha roots were markedly higher than those in WT roots(Fig.5C).

Na+and K+flux in the root meristem zone were measured by NMT.osrboha roots showed higher K+efflux(Fig.5E).However,there was no significant difference in Na+influx between osrboha and WT roots(Fig.5D).Thus,OsRbohA regulated K+homeostasis in roots under salt stress.

Fig.5.OsRbohA regulates K+homeostasis in roots under salt stress.(A)Na+contents,(B)K+contents,(C)Na+/K+,(D)Na+flux,and(E)K+flux in roots of osrboha mutants and WT seedlings exposed to salt stress.Ten-day-old seedlings of osrboha mutants and WT were treated with 100 mmol L-1 NaCl for 10 days and the Na+and K+contents in roots of osrboha mutants and WT seedlings were measured.Three-day-old seedlings of osrboha mutants and WT were treated with 100 mmol L-1 NaCl for 1 day,after which Na+and K+flux in the primary root meristem zone were detected by noninvasive micro-test technology.Values in(A-E)are means±SD(n=3).Means labeled with different letters in(A-C)are different(P≤0.05).

To investigate the distribution of K+in the root cells under salt stress,the content of K+in root subcellular fraction of WT and osrboha mutants was measured.NaCl treatment reduced the contents of K+in the mitochondria,soluble fraction,and plasma membrane of WT and osrboha mutant roots(Fig.6C,E),whereas there were no significant differences in the contents of K+in the plastid and nucleus(Fig.6A,B).The level of K+contents were significantly decreased in the soluble fraction and plasma membrane of osrboha plants roots compared to WT under salt stress(Fig.6D,E),but there were no significant differences in mitochondria between osrboha and WT plant roots under salt stress(Fig.6C).

3.8.OsRbohA mediated the transcriptional regulation of genes encoding key potassium transporters and channels under salt stress

To further investigate the function of OsRbohA in the K+homeostasis regulation under salt stress,we measured the expression of key genes encoding K+transporters and channels(OsAKT1 and OsGORK channel of K+;OsHAK1,OsHAK5,and OsHAK21 for affinity K+uptake)in the roots of osrboha and WT under NaCl stress[55].NaCl treatment significantly induced the expression of OsGORK(Fig.7A),OsAKT1(Fig.7B),OsHAK1(Fig.7C),OsHAK5(Fig.7D)and OsHAK21(Fig.7E)in the roots of WT plants,and NaClinduced up-regulation in the expression of OsGORK,OsAKT1,OsHAK1,and OsHAK5 was significantly decreased in roots of osrboha plants.However,the expression levels of OsHAK21 in the roots of osrboha mutants were the same as those in WT roots exposed to salt stress.These results suggested that OsRbohA positively affected the expression of OsGORK,OsAKT1,OsHAK1,and OsHAK5 in rice roots under salt stress.

3.9.Overexpression of OsRbohA increased K+homeostasis in roots under salt stress

To further determine the role of OsRbohA in the regulation of K+homeostasis,two independent OsRbohA-overexpressing(OE)lines(OsRbohA-OE1 and OsRbohA-OE2)were used.In the absence of NaCl,there were no significant differences between OsRbohA-OE lines and WT plants with respect to the contents of Na+(Fig.S7A),K+(Fig.8A),and the Na+/K+ratio(Fig.S7B)in roots.In the presence of NaCl,the content of K+in both the roots of WT plants and OsRbohA-OE lines was markedly reduced(Fig.8A),and a higher K+content was observed in roots of OsRbohA-OE lines than in WT(Fig.8A).There was no significant difference in root Na+content between OsRbohA-OE lines and WT plants exposed to salt stress(Fig.S7A).The Na+/K+ratios in OsRbohA-OE roots were lower than those in WT roots(Fig.S7B).Na+and K+flux were observed in the meristem root zones of OsRbohA-OE roots and WT roots by NMT.The OsRbohA-OE roots showed a lower K+efflux than WT(Fig.8B).There was no significant difference in Na+influx between OsRbohA-OE and WT roots(Fig.S7C).

Fig.6.Subcellular K+concentration in roots under salt stress.(A-E)K+contents in the plastid,nucleus,mitochondria,soluble fraction,and plasma membrane of osrboha mutants and WT roots exposed to salt stress.Ten-day-old seedlings of osrboha mutants and WT were treated with 100 mmol L-1 NaCl for 2 days and K+contents in the plastid,nucleus,mitochondria,soluble fraction,and plasma membrane of osrboha mutants and WT roots were measured.Values are means±SD(n=3).Means labeled by different letters are different(P≤0.05).

The expression levels of OsAKT1,OsGORK,OsHAK1,OsHAK5,and OsHAK21 were also measured in roots of OsRbohA-OE and WT under NaCl stress.As shown in Fig.8C-G,the expression levels of OsGORK,OsAKT1,OsHAK1,and OsHAK5 in the roots of OsRbohA-OE lines were markedly higher than those in WT roots exposed to salt stress,whereas the expression of OsHAK21 in the roots of OsRbohAOE lines was the same as that in WT roots exposed to salt stress.Thus,overexpression of OsRbohA increased K+homeostasis in roots under salt stress.

4.Discussion

4.1.OsRbohA is required for salt tolerance in rice

ROS production under abiotic stress is considered a mechanism[29]of defense in plants against complex environmental stresses,and NADPH oxidase(Rboh)as a producer of ROS has been widely studied[12]in the regulation of environmental stress and growth and development processes in plants.Pumpkin-grafted cucumber plants increased their salt tolerance by regulating NADPH oxidase-dependent H2O2production and increasing Na+exclusion in the roots[56].Arabidopsis AtRbohB and AtRbohD functioned in plant heat stress response[32]and AtRbohI functioned in plant drought stress response[30].These reports imply that the members of Rboh family play diverse and extensive roles in adaption to stresses.Nine Rboh genes(OsRbohA-OsRbohI)have been found in rice[17].Previous studies[38,40]found the response only of rice Rboh genes to drought stress.The role of rice NADPH oxidase in salt tolerance has been not elucidated.

In this study,we found that OsRbohA positively regulated salt stress tolerance in rice based on the following results.First,NaCl induced the expression of OsRbohA in both shoots and roots(Fig.1A,B);second,OsRbohA positively regulated salt stress tolerance in rice and alleviated the oxidative damage caused by salt stress(Figs.2,S4),and exerted a positive effect on photosynthetic capacity(Fig.3);third,OsRbohA regulated NaCl-induced increase in NADPH oxidase activity and H2O2content(Fig.4);and fourth,OsRbohA was essential to regulating seed germination,root growth and K+homeostasis under salt stress(Figs.5-8,S5,S6).

4.2.OsRbohA regulates K+homeostasis in response to salt tolerance in rice roots

Ion homeostasis plays an important role in plant stress tolerance.Because K+plays an essential role in regulating the activity of various enzymes and osmosis,the ratio of Na+to K+is considered[54,57]to determine the plant’s ability to survive in saline environments.The amount of NaCl-induced K+efflux is strongly correlated with cellular K+retention and salt stress tolerance in variety of species,including poplar[58],barley[59],wheat[60],and sweet potato[50].Under salt stress,plants assimilate a large number of Na+ions,resulting in K+deficiency in many species including rice and Arabidopsis[8,61].In the present study,knockout of OsRbohA caused K+deficiency(Fig.5B,E),which occurred mainly in the subcellular structure including soluble fraction and plasma membrane(Fig.6),and overexpression of OsRbohA reduced the loss of K+ions in roots(Fig.8A,B).Ma et al.[35]reported that the Arabidopsis double mutants atrbohD/F showed salt hypersensitivity phenotypes and that atrbohD/F disrupted both Na+and K+homeostasis.However,in the present study,mutation in OsRbohA or overexpression of OsRbohA regulated K+homeostasis but did not affect Na+homeostasis.It may be that Rboh regulatory mechanisms differ among plant species.Neither atrbohD nor atrbohF affected Na+and K+homeostasis[35].Thus,the single OsRbohA deficiency was not able to modulate both Na+and K+homeostasis,implying that there are other OsRbohs that also function in this process.Further study may reveal the function of OsRbohs under salt stress.

Fig.7.OsRbohA mediates the transcriptional regulation of OsGORK,OsAKT1,OsHAK1,and OsHAK5 under salt stress.(A-E)Transcript levels of OsGORK,OsAKT1,OsHAK1,OsHAK5,and OsHAK21 in roots of osrboha mutants and WT seedlings exposed to salt stress.Ten-day-old seedlings of osrboha mutants and WT were treated with 100 mmol L-1 NaCl for the indicated times and the expression levels of the named genes were measured.Values are means±SD(n=3).

4.3.OsRbohA-mediated H2O2 accumulation modulates K+homeostasis

The NADPH oxidase-mediated production of ROS has been shown[62]to act in regulating plant acclimation to salinity stress.Demidchik et al.[63]has suggested that ROS regulated Na+/K+homeostasis by elevating plant cytosolic Ca2+levels.We found that knockout of OsRbohA led to decreases in H2O2content(Fig.4E)and K+accumulation(Fig.5B)in rice under salt stress,suggesting that OsRbohA might affect H2O2accumulation to modulate K+homeostasis,thus increasing the salt stress tolerance of rice plants.Ma et al.[35]reported that ROS produced by both AtRbohD and AtRbohF function as signal molecules to regulate Na+/K+homeostasis.The highest similarities to AtRbohD in rice by sequence alignment were those of OsRbohB(59%)and OsRbohI(63%),whereas OsRbohA showed only 48%.The highest similarity to AtRbohF in rice was OsRbohC(64%),whereas OsRbohA showed 53%.Thus,we hypothesize that OsRbohA is a unique salt-tolerance Rboh gene in rice that is different from those of Arabidopsis thaliana.

4.4.OsRbohA mediates the transcriptional regulation of genes encoding K+transporters and channels under salt stress in rice roots

A previous study[64]showed that ROS-activated K+channels are an important pathway for modulating root K+leakage under saline conditions.In our study,OsRbohA deficiency inhibited increases in expression of genes encoding K+transporters and channels(OsAKT1,OsGORK,OsHAK1,and OsHAK5)under salt stress(Fig.7),whereas overexpression of OsRbohA promoted increased expression of these genes(Fig.8C-G).AKT-family channels,high-affinity potassium transporter(HKT)[65],and KUP/HAK/KT-family(HAK)transporters[66]are involved in compartmentation,exclusion,and transportation of K+.Up-regulation of OsHAK5 transcripts was an essential part of the maintenance of plant ionic homeostasis under stress conditions[7].The K+efflux induced by stress may be an adaptation to stress response by decreasing K+concentration in the cytoplasm[67].However,long-term K+loss from the root would impair plant nutritional status[68].Thus,the roots need to allow stress-induced K+efflux without impairing the nutritional requirements for K+in plants[69].The above K+efflux occurs in a highly tissue-specific manner and is confined to the root apex[69].We conjecture that OsRbohA is part of the process upregulating the transcription of OsAKT1,OsGORK,OsHAK1,and OsHAK5 genes in rice roots.However,the mechanism by which OsRbohA regulates the transcription of these genes to modulate K+fluxes remain to be determined.

Fig.8.Effects of OsRbohA overexpressers on K+content,K+efflux,and transcriptional regulation of OsGORK,OsAKT1,OsHAK1,OsHAK5,and OsHAK21 under salt stress in roots.(A)K+contents,(B)K+flux,and(C-G)transcript levels of OsGORK,OsAKT1,OsHAK1,OsHAK5,and OsHAK21 in roots of OsRbohA overexpressers(OE)and WT seedlings exposed to salt stress.Ten-day-old seedlings of OsRbohA-OE lines and WT were treated with 100 mmol L-1 NaCl for 10 d,and then the K+contents in roots of OsRbohA-OE lines and WT seedlings were measured.Three-day-old seedlings of OsRbohA-OE lines and WT were treated with 100 mmol L-1 NaCl for 1 d,and then the K+flux at the primary root meristem zone was measured using NMT.Ten-day-old seedlings of OsRbohA-OE lines and WT were treated with 100 mmol L-1 NaCl for the indicated times,and the expressions of the above genes were measured.Values in(A-G)are means±SD(n=3).Means labeled with different letters in(A)are different(P≤0.05).

Based on these results,we propose a working model that describes the role of OsRbohA in the tolerance of rice plants to salt stress(Fig.9).The increasing of NADPH oxidase activity and H2O2production by NaCl stress are dependent on OsRbohA in rice plants.OsRbohA-dependent H2O2accumulation modulates K+homeostasis,thus increasing the tolerance of rice plants to salt stress.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

CRediT authorship contribution statement

Qingwen Wang:Methodology,Writing-original draft,Funding acquisition,Project administration,Data curation,Formal analysis.Lan Ni:Data curation,Formal analysis,Methodology.Zhenzhen Cui:Writing-review & editing,Methodology.Jingjing Jiang:Writing-review & editing,Methodology.Chao Chen:Methodology.Mingyi Jiang:Writing-review & editing,Funding acquisition,Project administration,Supervision.

Acknowledgments

This study was supported by the National Natural Science Foundation of China(31671606,31971824)and Postgraduate Research and Practice Innovation Program of Jiangsu Province(KYCX18_0743).We are grateful to Prof.Kunming Chen(Northwest A&F University)for providing the OsRbohA overexpressers.

Accession numbers

Sequence data in this article can be found in the GenBank/EMBL data libraries under the following accession numbers:GADPH(Os02g0171100),OsRbohA(Os01g0734200),OsGORK(Os06g0250 600),OsAKT1(Os01g0648000),OsHAK1(Os04g0401700),OsHAK5(Os01g0930400),and OsHAK21(Os03g0576200).

Appendix A.Supplementary data

Supplementary data for this article can be found online at https://doi.org/10.1016/j.cj.2022.03.004.