Infection and Colonization of Pathogenic Fungus Fusarium proliferatum in Rice Spikelet Rot Disease

Sun Lei, Wang Ling, Liu Lianmeng, Hou Yuxuan, Xu Yihua, Liang Mengqi, Gao Jian, Li Qiqin, Huang Shiwen

?

Infection and Colonization of Pathogenic Fungusin Rice Spikelet Rot Disease

Sun Lei1, 2, Wang Ling2, Liu Lianmeng2, Hou Yuxuan2, Xu Yihua1, 2, Liang Mengqi2, Gao Jian2, Li Qiqin1, Huang Shiwen1, 2

(College of Agronomy, Guangxi University, Nanning 530003, China; State Key Laboratory of Rice Biology, China National Rice Research Institute, Hangzhou 310006, China)

Rice spikelet rot disease (RSRD), caused by, is an emerging disease. So far, the effects of diseased rice floral organs as well as the primary infection sites and stages of this pathogen are not determined. We investigated changes in the floral organs, along with the infection processes of the pathogen in plants inoculated withand labelled with a green fluorescent protein during different growth stages of rice. The results showed that RSRD is not a systemic infectious disease, which has negative effects on the fertility of the infected rice.caused brown colored anthers, crinkled pistils and ovaries, pollen grain deformities and anther indehiscence. The number of pollen grains on the stigmas decreased significantly in the infected spikelets, and the anther dehiscence and seed-setting rate successively declined by 69% and 73%, respectively, as a result of the infection. The initial infection stage occurred at the pollen cell maturity stage, and the primary invasion sites were determined to be the anthers of rice. It was noted that the pathogen mainly damaged the pollen cells, and with the exception of the filaments, proceeded to colonize the pistils and endosperm.

; rice spikelet rot disease; green fluorescent protein; infection process; infection stage; invasion site

Rice spikelet rot disease (RSRD), caused by, is a panicle disease which occurs during the late growth stage in rice (Huang et al, 2011a). The disease causes rice grains to rot and discolor, and results in deformations in grains and reductions in grain yield (Li et al, 2015). The symptoms of the disease are rust red or yellowish-brown oval spots on the glumes during the early growth stage, which change to brown, yellowish brown, or dark brown lesions at the later stages (Hou et al, 2013). Seriously infected rice grains have white or pink mold layers covering the grains, which results in rice sterility (Li et al, 2015). The ripening grains infected bymay result in decreases in seed-setting rate and 1000-grain weight (Huang et al, 2011b). RSRDaffects both grain yield and grain quality due to the pathogen producing fumonisin toxins (Huang et al, 2011b). The fumonisin influences human food safety and animal husbandry health (Rheeder et al, 1992; Burger et al, 2010).

The prevalence of RSRD is closely related to the rice varieties and climate conditions. The occurrence of RSRD has increased seriously with the large-scale application ofandhybrid rice varieties (Huang et al, 2011b). High humidity conditions during the late booting to flowering stage could aggravate the severity of the disease (Huang et al, 2011b). In recent years, the incidence of RSRD has been found frequently in the Yangtze River region of China (Huang et al, 2011b). However, the cycle and infection process of RSRD remain unclear. In this study, three aspects regarding the infection process ofwere addressed. Firstly, the stage in whichinfected the rice plants was examined. Secondly, it was determined whether the disease was systemic-infection. Finally, whether or not, the invasion sites ofoccurred in all the floral organs or in specific organs. The pathogens were labeled with green fluorescent protein (GFP), and the infection progress of the pathogenpost-inoculations was continuously monitored.

GFP has been widely used due to its stable fluorescence properties, intuitionistic properties, convenience of operation, requiring no additions of exogenous substrates, and ability to be directly detected in living cells (Cormack, 1998). The GFP reporter gene can randomly be inserted into the fungal genome, and it has been successfully applied in studies related to the ecology of fungi, infection modes of biocontrol bacteria to pathogens, and the relationships between pathogens and hosts (Chen et al, 2003). GFP are widely used in fungal gene transcriptions, protein and organelle localizations, cell substructure identifications, and protein functions through fusion methods with the target genes (Xu et al, 2008). For example,labeled by GFP was previously used to observe the infection processes of watermelon seedlings under confocal laser scanning microscope (CLSM) (Li et al, 2011). Also,was transformed with GFP, and its infection patterns in barley andwere then studied in detail (Skadsen and Hahn, 2004). In the current study,was labelled by GFP in order to explore the progress and infection cycle for RSRD. The results provided a foundation for the management of RSRD and also facilitated the studies of pathogenic processes of.

Materials and methods

Materials

The inbredrice Xiushui 134 was used. The 9FP strain ofwas isolated and identified at the China National Rice Research Institute, Hangzhou, China (Huang et al, 2011a). The plasmid of pCPXHY2GFP with GFP protein was kindly provided by Professor Chen Baoshan from Guangxi University, Nanning, Guangxi Province, China (Yang et al, 2011).

Methods

Protoplast preparation

was activated by potato dextrose agar (PDA) medium plates and placed into a potato dextrose (PD) liquid medium, and incubated in a rotary shaker (180 r/min) at 28 oC for 5 d. The conidia suspension was collected and adjusted to 1 × 107spore/mL. Then, 2 mL conidia suspension was added to 100 mL PD liquid medium. Additional shaking of the culture (28 oC, 180 r/min) was carried out for 10 to 14 h. The young germlings were collected and placed into a 50 mL conical flask. Then, 10 mL lysate (20 mg/mL driselase, 10 mg/mL lysing enzyme, 0.7 mol/L NaCl) was added, and gently mixed at 28 oC, with 85 r/min for 2 to 3 h. The solution mixture was filtered with three layers of sterile lens paper, and then rinsed five times with 0.7 mol/L NaCl solution. The filtrate was collected into a 50 mL centrifuge tube and centrifuged at 4 oC with 5 000 r/min for 5 min. The supernatant was then discarded. In accordance with the volume of the protoplast precipitation, an appropriate volume of 0.7 mol/L NaCl solution was added for the resuspension. The 1 mL suspension was appended to a 2 mL centrifuge tube and centrifuged at 4 oC with 5 000 r/min for 2 min. Following this, 1 mL STC solution (1.2 mol/L sorbitol, 10 mmol/L Tris-HCl, 50 mmol/L CaCl2, pH 7.5) was added in order to suspend the protoplast precipitation. It was subsequently centrifuged at 4 oC with 5 000 r/min for 2 min, and the supernatant was discarded. Finally, 1 mL STC solution was used in order to resuspend the protoplast precipitation with a 1/4 volume of SPTC solution (STC with 40% PEG4000) added dropwise and mixed gently.

Protoplast transformations

A total of 10 μg pCPXHY2GFP plasmids and 10 μL of 50 mg/mL heparin sodium solution were added to the aforementioned mixed solution. The solution was gently mixed upside down, and incubated on ice for 30 min. Then, 400 μL SPTC solution was added to the tube, and again gently mixed upside down. The solution was incubated at room temperature and protected from light for 20 min. The mixed solution was then moved into a conical flask which contained 20 mL of regeneration medium (1 g yeast extract, 1 g casamino acid, 274 g sucrose, pH 7.0), and incubated at room temperature for 2 h before incubating in a rotary shaker (90 r/min) at 28 oC for 16 h approximately. Then, the resuscitation protoplasts were added to the PDA medium with 100 mmol/L. Approximately 15 mL medium was incubated per plate at 25 oC for 3 to 5 d. Finally, the selected transformants were transferred to a newresistant plate for future use.

Screening of the transformants

The hyphae of the transformant were collected and the DNA was extracted using the CTAB method. Specific primers (GFP-F: CACCCAACAAACCATCAATC; GFP-R: GCCGTTGACGCCGTGTTCC) were used to check thegene. The CLSM was used for detecting the fluorescence of the positive cloned transformants (excitation of 488 nm and emission at 543 nm for GFP). The stronger fluorescent signal transformants were then selected to measure the morphological characteristics and pathogenicity, with a wild type strain as a control. The genetic stability of transformants was analyzed, and was similar to the wild type strains.

Seed germination stage: Rice seeds were disinfected for 5 min with 3% sodium hypochlorite solution, and then washed three times with sterile water. The spore suspension ofwas added to the rice seeds at 24 h before sowing, and the germination of the seeds was observed after the soaking treatment. The germinated seeds were sown into sterilized soil and observed at 7 and 14 d after sowing.

Rice seedling stage: Rice seedlings at the 3.5 leaf stage were sprayed with a spore suspension ofuntil the rice leaves displayed water droplets. Samples were collected at 7 and 14 d after innoculation.

Booting stage: The young panicles were injected with the spore suspension ofuntil overflow was reached at 6 d prior to heading (pollen maturation stage). Then, rice samples were observed at 24, 36, 48, 60 and 72 h after inoculation (HAI).

Start heading stage: The stem-sheath of the rice panicles was removed and small openings were cut on the top of each spikelet at 3 d before heading occurred (pollen maturation stage). Then, the spore suspension ofwas injected into each spikelet until overflow was reached. Rice samples were observed at 6, 12, 18, 24, 36, 48 and 60 HAI (Huang et al, 2011b).

Flowering stage: The spore suspension ofwas sprayed on the rice panicles until water droplets flow was observed, and samples were observed at 24 and 48 HAI (Huang et al, 2011b).

The rice plants (10 to 20 rice plants for each treatment) were placed in a greenhouse under controlled temperature (28 oC) and humidity (80%) conditions after inoculation. Rice plants inoculated with sterile water were served as the control.

Sampling observations

During the booting stage, the diseased and unflowered spikelets were collected at 48 HAI. The floral organs were gently removed with tweezers from the spikelets after the glume was removed. The diseased samples were spread evenly on a glass slide and recorded using a stereomicroscopy (Olympus, SZX9, Japan).

Pollen fertility: Samples were collected at 60 to 72 HAI during the booting stage. A drop of 1% I2-KI solution was added to the glass slide with the anthers. Tweezers were used to acquire the pollen from the pressed anthers, and then the anther residue was discarded. Then, the pollen fertility was observed under a fluorescence microscope (Leica, DM4000B, Germany).

Anther dehiscence: From 144 to 168 HAI at the booting stage, the spikelets were sampled from 9:30 to 11:30 am during the flowering stage and observed by a stereomicroscopy (Olympus, AZX7, Japan).

Pollen numbers on the stigma: From 144 to 168 HAI at the booting stage, the pistils were collected at 1.5 h after flowering and gently immersed into 1% aniline blue solution for 1 h and spread evenly on glass slides. The samples were observed under a fluorescence microscope (Leica, DM4000B, Germany) with an excitation wavelength of 350 nm.

Fig.1.Phenotype and pathogenicity oflabelled with green fluorescent protein (GFP).

A, Wild strain 9FP. B, Mutant strain Fp-GFP11. C, Pathogenicity of the wild strain 9FP. D, Pathogenicity of the mutant strain Fp-GFP11. E, Fp-GFP11 spores and mycelium under the bright field. F, Fp-GFP11 spores and mycelium under the laser field.

The inoculated rice samples, radicles and plumules during the germination stage, leaves, stems, and leaf sheaths during the seedling stage, and rice spikelets during the booting, start heading and flowering stages were collected and detected with CLSM. The surfaces of each sample were washed with sterile water. Tweezers were used to separate the different parts (rachilla, stamens, pistils, endosperm, lemma and palea) of the spikelets, and then, the samples were sliced with tweezer and anatomic knife, and evenly spread on glass slides. The slides were placed under the CLSM for examination purposes. At each time point, 10 spikelets were taken from each of the three rice plants for statistical analysis and observation.

Results

Screening of GFP labelled strains

After sub-culturing for five generations, the strain of Fp-GFP11 labelled with GFP protein was equal to the strain of wild type based on morphological characteristics (Fig. 1-A and -B) and pathogenicity tests (Fig. 1-C and -D). The Fp-GFP11 strain was found to have strong fluorescence under the CLSM (Fig. 1-F). Therefore, it was selected for the infection observation.

Locations of Fp-GFP11 infection

In order to explore the initial stages and sites of the infection, the young roots, germ, leaves, stems and leaf sheaths of the rice were observed using CLSM during the seed germination and rice seedling stages. The results showed that no pathogenic fungi were visible (data not shown). Also, when the spikelets were inoculated during the booting, start heading and flowering stages, no Fp-GFP11 were found in the longitudinal sections of the rachilla of the connected susceptible spikelets. However, infections were found on the stamens, pistils, endosperms, and lemmas and paleae (Tables 1 and 2). Therefore, the initial infection of RSRD pathogen was confirmed to occur during the booting stage, and the infection sites were determined as the spikelets.

Post-inoculation stage of rice floral organs

During post-inoculation stage, with spores of Fp-GFP11, the anthers were visibly browned, and the surface had become rough (Fig. 2-A and -C). Also, the pistils and ovaries shrank, and there was partially necrosis tissues compared to the control (Fig. 2-B and -D), indicating that infection could occur on anthers, pistils and ovaries.

Post-inoculation fertility-correlated characteristics of rice samples

During the post-inoculation stage, with spores of Fp-GFP11, the pollen grains were found to be malformed and unfilled (Fig. 3-A and -D), and the amount of anther dehiscence was significantly reduced compared with the control. Furthermore, the severely affected anthers had made no progression in the anther dehiscence (Fig. 3-B and -E) and there was almost no pollen observed on the stigma (Fig. 3-C and -F). The infected spikelets from each panicle were counted (Table 3). The results revealed that the anther dehiscence and seed-setting rate after inoculation had significantly declined by 69% and 73%, respectively. These findings confirmed that the pathogenic fungi had negatively affected the fertility of rice.

Table 1.Artificial inoculation during the booting and start heading stages (Mean ± SD,= 3).

HAI, Hours after inoculation. Different lowercase letters in the same column refer to significant differences at the 5% level among the treatments.

Table 2. Artificial inoculation during flowering stage.

HAI, Hours after inoculation. Data are Mean ± SD (= 3). Different lowercase letters in the same column refer to significant differences at the 5% level.

Fig. 2. Anthers, pistils and ovaries infected with.

A, Normal anther. B, Normal pistil and ovary. C, Susceptible anther. D, Susceptible pistil and ovary.

Fig. 3. Pollen fertility, anther dehiscence and pollen count on the stigma infected with.

A, Normal pollen. B, Normal anther. C, Normal pistil. D, Susceptible pollen. E, Susceptible anther. F, Susceptible pistil.

Table 3. Effects of different inoculation treatments on rice samples.

Data are Mean ± SD (= 3). Different lowercase letters in thesame column refer to significant differences at the 5% level.

Colonization of Fp-GFP11 during booting stage

After inoculated with the Fp-GFP11 strain, 23.33% of samples showed a small amount of hyphae colonizing on the outer surfaces of the lemma and palea at 24 HAI (Fig. 4-A and Table 1), indicating that pathogens can colonize the rice spikelet surface. The hyphae colonized on the outer surfaces (Fig. 4-B) and inner surfaces (Fig. 4-C) of both the lemma and palea at 36 HAI, confirming that the pathogen had the ability to penetrate the lemma and palea. Furthermore, the infection rate of the lemma and palea were also significantly increased (Table 1). Then, the hyphae were found to penetrate the anther epidermis (Fig. 4-D) and extend between the pollen cells in the anthers at 48 HAI (Fig. 4-E), with 23.33% of the stamens infected (Table 1). The hyphae penetrated and damaged the pollen cells, which were deformed and ruptured at 60 HAI (Fig. 4-F). The hyphae also extended to the pistils with the pollen cells (Fig. 4-G) and 23.33% of the pistils was infected (Table 1). Finally, the anthers were observed to be completely infected by the mycelial network at 72 HAI, and more internal pollen cells were damaged (Fig. 4-H). The pathogen primarily affected the pollen cells in the anthers and had no obvious infection effects on the other floral organs. Severe infections during this stage would lead to the death of the rice spikelets, and would have significant influences on the fertility and seed-setting rate of rice.

Colonization of Fp-GFP11 during start heading stage

With the Fp-GFP11 strain, the majority of the spores were located on the anthers at 6 HAI (Fig. 5-A), and 66.67% of the stamens were infected (Table 1), implying that anthers play an important role in the pathogen infection. Moreover, other floral organs in the spikelets had no obvious damages (with the exception of the anthers), and the pathogen only colonized on the anthers at the early stage of the infection (Table 1). These findings indicated that the anther was the unique organ of the pathogen infection and further confirmed that the initial infection site of the pathogen was the anthers. However, the hyphae penetrated the anther epidermis at 12 HAI (Fig. 5-B) and the infection rate of stamens was also significantly increased (Table 1). The hyphae extended (Fig. 5-C) and invaded (Fig. 5-D) the pollen cells in the anthers, then penetrated the pollen cells without obvious abnormal pollen cells from 18 to 24 hpi. Furthermore, the infection rate of stamen reached the peak. The pollen cells were obviously deformed and ruptured at 36 HAI (Fig. 5-E). Then, all of the anthers were covered with mycelium, and more internal pollen cells were damaged at 48 HAI (Fig. 5-F). Moreover, 33.33% of the pistils with pollen cells also had some degree of colonized mycelium (Fig. 5-G and Table 1). The colonization of hyphae extended to the surfaces of lemma and palea for 43.33% of the samples at 60 HAI (Fig. 5-H and Table 1), which indicated that the pathogen had the ability to expand through the lemma and palea. Serious infection during this stage would also lead to the deaths of the diseased spikelets, which would have significant influences on the fertility and seed-setting rate of rice.

Colonization of Fp-GFP11 during flowering stage

In this study, the hyphae of Fp-GFP11 strain colonized on outer surfaces of the lemma and palea for 23.33% of the samples at 24 HAI (Fig. 6-A and Table 2). Then, the hyphae colonized on the surfaces of the endosperm without typical infective hyphae at 48 HAI (Fig. 6-B), and 23.33% of the endosperm was infected (Table 2). The results indicated that the pathogen displayed the ability to expand through the lemma and palea in order to colonize on the surfaces of the endosperm with the spraying inoculations during the flowering stage. However, the pathogen did not obviously infect the endosperm itself. No serious infections causing death to the hosts were found and relatively small impacts on the rice seed-setting rate were observed.

Fig. 4.Effects of Fp-GFP11 infection process on rice floral organs during the panicle initiation stage.

A, 24 hours after inoculation (HAI). B and C, 36 HAI. D and E, 48 HAI. F and G, 60 HAI. H, 72 HAI. The arrows indicate the Fp-GFP11.

Fig.5.Effects of Fp-GFP11 infection process on rice floral organs during the start heading stage.

A, 6 hours after inoculation (HAI). B, 12 HAI. C and D, 18 to 24 HAI. E, 36 HAI. F and G, 48 HAI. H, 60 HAI. The arrows indicate the Fp-GFP11.

Fig.6.Effect of Fp-GFP11 infection on rice floral organs during the flowering stage.

A, 24 hours after inoculation (HAI). B, 48 HAI.The arrows indicate the Fp-GFP11.

Discussion

The rice samples were inoculated withlabeled with GFP under different inoculation methods or at various growth stages. The buds of panicle were inoculated using the injection method in order to simulate the process of the pathogenic fungi infection (from the outside to the inside) during the booting stage. The pathogen extended into the interiors of the spikelets by expanding through the gaps of the lemma and palea. In a previous study of rice false smut, the conidia were able to form mycelium on the surfaces of the glume, and then extend to the interior of the glume hulls via the glume openings (Dai et al, 2005).may also penetrate into the glume by directly extending into the inner parts of the spikelets. However, it is still unclear how the pathogen directly penetrates the hard glume hulls. The cytoderm of graminaceous plants is mainly composed of cellulose, xylan and pectin, which constitute the natural barriers of the plants and impede the invasions of pathogens (Carpita and Gibeaut, 1993). The pathogens have evolved to overcome the natural barriers of host plants. Plant pathogens display the ability to produce cytoderm degrading enzymes (such as cellulase, xylanase and pectinase) during the infection process to soften and dissolve the host cytoderm, facilitate the invasions and nutrient absorption of the pathogens, and finally establish parasitic relationships (Cooper, 1983; Kang et al, 2002). The labeling densities for cellulose, xylan and pectin in the cell walls of infected wheat spikes are significantly reduced as compared with that of healthy wheat spikes (Kang et al, 2007). The results provide evidence thatmay produce cell wall degrading enzymes during its infection and colonization on wheat spikes (Kang et al, 2007).

The injection of the spikelets may stimulate the infection process from the inner to the outer side during the start heading stage in this study. Pathogen colonization was seldom found on the glumes and other floral organs (with the exception of the anthers) at the early stage of the infection. The colonization of the glumes occurred at the later stage of the infection. Therefore, the pathogen of RSRD displayed organ specialization, and its primary infection site was anthers. Compared to the results of rice false smut (Tang et al, 2013), the pathogens of the two diseases both display organ specialization, and the booting stage of rice is an important period for infection. However, the initial infection sites, mode of infection and life history of the pathogen are different. The primary infection sites of the pathogen for rice false smut are the upper parts of the three stamen filaments located between the ovaries and the lodicules (Tang et al, 2013). Also, the stigma and lodicules are occasionally infected to a limited extent (Tang et al, 2013; Hu et al, 2014). During the infection and development of the rice false smut disease, the pathogen forms no haustoria and directly penetrates the host cell walls. In the rice false smut balls, the ovaries remain uninfected and alive. Therefore, the life of pathogen is a biotrophic parasite (Tang et al, 2013). In contrast, this study found that the initial infection sites of RSRD were anthers. The infection extended downward from the anthers to the periphery of the pistils. However, no colonization of the filaments was observed. Therefore, the expansion of the infection may have been accomplished by pollination with the infected pollen. During the booting and start heading stages of the Fp-GFP11 infection, the pathogen formed typical infective hyphae, and the hyphae penetrated the pollen directly. The hosts were alive at the beginning of the infection. However, the tissue of hosts would finally die as the Fp-GFP11 pathogen spread. With Fp-GFP11 infection during the flowering stage, the pathogen did not form typical infective hyphae or haustoria, and the hosts did not die during this stage. This suggested that the pathogen ofwas a hemibiotroph parasite.

The main pathogen of RSRD is, and wheat head blight is caused by. Although the wheat head blight and rice spikelet rot are caused by thefungi, there are significant differences during the infection processes. For example, the pathogen of wheat head blight is considered to infect the anthers first, and then spread through the anthers to the ovaries, glumes and spikelets. Therefore, the anthers play an important role in the expansion of the infection (Pugh et al, 1933). However, recent studies have found that the hyphae on the outer surfaces of the glume could extend over the edges to the inner surfaces (Kang et al, 2007; Zhang et al, 2008). Then, penetration of the host tissues would occur on the inner surfaces of the glume, lemma and palea, and on the upper parts of the ovaries (Kang and Buchenauer, 2000; Kang et al, 2004). The pathogen can be extended through the compact tissue to the rachis, and then infect the adjacent spikelets by spreading upward and downward to the adjacent florets inter- and intra-cellularly in the vascular bundles and cortical tissue of the rachis (Zhang et al, 2008). However, the pathogencould not infect the spikelets rachis or expand between adjacent spikelets.varieties and the hybrid combinations with the tightened panicles are more susceptible thanvarieties with loosened panicles (Huang et al, 2011b). It was found to be propitious to the disease occurrence and epidemic if the transition from the late booting to the flowering stage occurred during overcast, rainy (high humidity), and warm (25 oC to 33 oC) climate conditions (Huang et al, 2011b). The transmission of the pathogen may be caused by the pollination, migration of conidia and direct contact between the susceptible grains and the non-susceptible grains. In this study,had the ability to produce toxic fumonisins, whileproduced trichothecenes. In the study of wheat head blight, the biosynthesis of trichothecenes induces the formation of the pathogen infection structures (Boenisch and SchaFer, 2011). However, in the study of maize ear rot,may be beneficial to the infection of maize seedlings by, and the maize varieties not sensitive to FB1 show resistance to the infected strain (Desjardins et al, 2007). FB1 inmay be due to its structural similarity to sphingosine, which affects the biosynthesis of sphingolipids, eventually leading to programmed cell death in plants (Tsegaye et al, 2007; Teng et al, 2008; Shi et al, 2009). However, its molecular mechanism remains unclear, and further research is still required.

The results of the inoculation tests during different growth stages showed that neither the spore dressing during the germination stage nor the spraying of the spore suspension during the seedling stage, resulted in RSRD, meanwhile the pathogen did not colonize in the host. These findings indicated that RSRD was not a systemic-infection disease. From the booting stage to the flowering stage, the pathogen was able to colonize and infect the rice floral organs. According to these findings, the initial infection stage of the pathogen was the mature period of the pollen cell stage. Also, the infecting stage could range from the booting stage to the flowering stage. In the field survey, the spikelets infected before booting stage caused sterility of rice. According to this experiment, the pathogen mainly infected the rice anthers, which then resulted in anther indehiscence. The amount of pollen on the stigma was obviously decreased. With the low amount of pollen, stigma pollen germination and anther indehiscence lead to sterility of spikelets (Matsui et al, 2001; Matsui and Omasa, 2002; Prasad et al, 2006). In the field experiments of fungicide, there was no significant control efficiency when the chemicals were sprayed on plants prior to the booting stage and after flowering stage. However, the control efficiency was dramatically enhanced when the test chemicals were sprayed during the booting stage, which suggested that the booting stage was the key point for the infection of RSRD (Huang et al, 2011b). Generally speaking, the life cycles of rice anthers are very short. Meanwhile, pathogen development requires major nutrition sources. How the pathogens identify the anthers and established colonization remains unclear, and the biological mechanism of the pathogen’s selective infection of rice anther as well as the metabolism requires further study.

Acknowledgements

This study was supported by the National Key Research and Development Program of China (Grant Nos. 2016YFD0200801, 2017YFD0300409 and 2018YFD 020030405), National Natural Science Foundation of China (Grant No. 31800133), Zhejiang Provincial Natural Science Foundation of China (Grant No. LQ18C140005), Agriculture, Rural Areas, and Farmers Six-Party Science and Technology Cooperation Projects of Zhejiang Province (Grant No. CTZB- F160728AWZ-SNY1-4), the Innovation Project of the Chinese Academy of Agricultural Sciences (CAAS), the Collaborative Innovation Project of the CAAS (Grant No. CAAS-XTCX2016012), the Core Research Budget of Nonprofit Governmental Research Insititute of China (Grant No. 2014RG005-2) and Zhejiang Key Research and Development Program of China (Grant No. 2019C02018).

Boenisch M J, Sch?Fer W. 2011.forms mycotoxin producing infection structures on wheat., 11: 110.

Burger H M, Lombard M J, Shephard G S, Rheeder J R, van der Westhuizen L, Gelderblom W C A. 2010. Dietary fumonisin exposure in a rural population of South Africa., 48: 2103–2108.

Carpita N C, Gibeaut D M. 1993. Structural models of primary cell walls in flowering plants: Consistency of molecular structure with the physical properties of the walls during growth., 3(1): 1–30.

Chen N, Hsiang T, Goodwin P H. 2003. Use of green fluorescent protein to quantify the growth ofduring infection of tobacco., 53(1): 113–122.

Cooper R M. 1983. The mechanisms and significance of enzymic degradation of host cell walls.: Callow J A. Biochemical Plant Pathology. Wiley: 101–135.

Cormack B. 1998. Green fluorescent protein as a reporter of transcription and protein localization in fungi., 1(4): 406–410.

Dai G H, Zhao J, He R M, Jin S X. 2005. Histochemical observation on the resistant and susceptible varieties to(Cooke) Tak and the way of infection of conidia., 35(1): 37–42. (in Chinese with English abstract)

Desjardins A E, Busman M, Muhitch M, Proctor R H. 2007. Complementary host-pathogen genetic analyses of the role of fumonisins in the-interaction., 70: 149–160.

Hou E Q, Zhang P S, Wang L, Liu E Y, Liu L M, Huang S W. 2013. Occurrence, epidemical regularity and controlling of rice spikelet rot disease (RSRD) and pathogenicity of its pathogens., 39(1): 121–127. (in Chinese with English abstract)

Hu M L, Luo L X, Wang S, Liu Y F, Li J Q. 2014. Infection processes of, during artificial inoculation of rice panicles., 139(1): 67–77.

Huang S W, Wang L, Liu L M, Tang S Q, Zhu D F, Savary S. 2011a. Rice spikelet rot disease in China: 1. Characterization of fungi associated with the disease., 30(1): 1–9. (in Chinese with English abstract)

Huang S W, Wang L, Liu L M, Tang S Q, Zhu D F, Savary S. 2011b. Rice spikelet rot disease in China: 2. Pathogenicity tests, assessment of the importance of the disease, and preliminary evaluation of control options., 30(1): 10–17. (in Chinese with English abstract)

Kang Z S, Buchenauer H. 2000. Ultrastructural and immunocyto- chemical investigation of pathogen development and host responses in resistant and susceptible wheat spikes infected by., 57(6): 255–268.

Kang Z S, Buchenauer H. 2002. Studies on the infection process of, in wheat spikes: Degradation of host cell wall components and localization of trichothecene toxins in infected tissue., 108(7): 653–660.

Kang Z S, Huang L L, Buchenauer H, Han Q M, Jiang X L. 2004. Cytochemistry of cell wall component alterations in wheat spikes infected by., 37(6): 623–628. (in Chinese with English abstract)

Kang Z S, Huang L L, Han Q M, Zhang H C. 2007. Cytology of infection process ofon wheat spikes., 34(4): 329–335. (in Chinese with English abstract)

Li C Q, Liang H S, Xia Y J, Peng M. 2011. Observation of the infection process of watermelon byf.sp. niveum using the GFP marker., 32(10): 1935–1939. (in Chinese with English abstract)

Li L, Liu L M, Wang G R, Wang A J, Wang L, Sun L, Li Q Q, Huang S W. 2015. Research progress of spikelet rot disease and bacterial panicle blight of rice., 29(2): 215–222. (in Chinese with English abstract)

Matsui T, Omasa K, Horie T. 2001. The difference in sterility due to high temperatures during the flowering period among-rice varieties., 4(2): 90–93.

Matsui T, Omasa K. 2002. Rice (L.) cultivars tolerant to high temperature at flowering: Anther characteristics., 89(6): 683–687.

Pugh G W, Johann H, Dickson J G. 1933. Factors affecting infection of wheat heads by., 46(9): 771–797.

Prasad P V V, Boote K J, Jr L H A, Sheehy J E, Thomas J M G. 2006. Species, ecotype and cultivar differences in spikelet fertility and harvest index of rice in response to high temperature stress., 95(2): 398–411.

Rheeder J P, Wfo M, Thiel P G, Sydenham E W, Shephard G S, van Schalkwyk D J. 1992.and fumonisins in corn in relation to human esophageal cancer in Transkei., 82(3): 353–357.

Shi L H, Bielawski J, Mu J Y, Dong H L, Teng C, Zhang J, Yang X H, Tomishige N, Hanada K, Hannun Y A, Zuo J R. 2009. Involvement of sphingoid bases in mediating reactive oxygen intermediate production and programmed cell death in., 17(6): 1030–1040.

Skadsen R W, Hohn T M. 2004. Use oftransformed withto follow infection patterns in barley and., 64(1): 45–53.

Tang Y X, Jin J, Hu D W, Yong M L, Xu Y, He L P. 2013. Elucidation of the infection process of(teleomorph:) in rice spikelets., 62(1): 1–8.

Teng C, Dong H L, Shi L H, Deng Y, Mu J Y, Zhang J, Yang X H, Zuo J R. 2008. Serine palmitoyltransferase, a key enzyme forsynthesis of sphingolipids, is essential for male gametophyte development in., 146(3): 1322–1332.

Tsegaye Y, Richardson C G, Bravo J E, Mulcahy B J, Lynch D V, Markham J E, Jaworski J G, Chen M, Cahoon E B, Dunn T M. 2007.mutants lacking long chain base phosphate lyase are fumonisin-sensitive and accumulate trihydroxy-18:1 long chain base phosphate., 282: 28195–28206.

Xu Y, Liu T G, He Y Q, Chen W Q. 2008. Application of green fluorescent protein to the studies on filamentous fungi., 34(6): 1–6. (in Chinese with English abstract)

Zhang X, van de Lee T, Lu W Z, Yu D Z, Ma H X. 2008. Infection ofon wheat spikes with green fluorescence protein-tagged revertants., 42(10): 3077–3082. (in Chinese with English abstract)

5 June 2018;

24 August 2018

Li Qiqin (qqli5806@gxu.edu.cn); Huang Shiwen (huangshiwen@caas.cn)

Copyright ? 2019, China National Rice Research Institute. Hosting by Elsevier B V

This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/)

Peer review under responsibility of China National Rice Research Institute

http://dx.doi.org/10.1016/j.rsci.2018.08.005

(Managing Editor: Li Guan)