Generation of recombinant rabies virus ERA strain applied to virus tracking in cell infection

ZHAO Dan-dan, SHUAl Lei, GE Jin-ying, WANG Jin-liang, WEN Zhi-yuan, LlU Ren-qiang, WANG Chong, WANG Xi-jun, BU Zhi-gao,

1 State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Harbin 150069, P.R.China

2 Jiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou University, Yangzhou 225009, P.R.China

Abstract The mechanism of rabies virus (RABV) infection still needs to be further characterized. RABV particle with self-fluorescent is a powerful viral model to visualize the viral infection process in cells. Herein, based on a reverse genetic system of the Evelyn-Rokitnicki-Abelseth (rERA) strain, we generated a recombinant RABV rERA-N/mCherry strain that stably expresses an additional ERA nucleoprotein that fuses with the red fluorescent protein mCherry (N/mCherry). The rERA-N/mCherry strain retained growth property similar to the parent strain rERA in vitro. The N/mCherry expression showed genetic stability during passage into mouse neuroblastoma (NA) cells and did not change the virulence of the vector. The rERA-N/mCherry strain was then utilized as a visual viral model to study the RABV-cell binding and internalization. We directly observed the red self-fluorescence of rERA-N/mCherry particles binding to the cell surface, and further co-localizing with clathrin in the early stage of infection in NA cells by fluorescence microscopy. Our results showed that the rERA-N/mCherry strain uses clathrin-dependent endocytosis to enter cells, which is consistent with the well-known mechanism of RABV invasion. The recombinant RABV rERA-N/mCherry thus appears to have the potential to be an effective viral model to further explore the fundamental molecular mechanism of rabies neuropathogenesis.

Keywords: rabies virus, self-fluorescence, binding, internalization

1. lntroduction

Rabies is still a severe zoonotic disease caused by rabies virus (RABV). Due to high-case fatality rate and no effective specific treatment, rabies is responsible for estimated 59 000 human deaths and heavy economic burden per year worldwide (Rupprecht et al. 2017; Minghui et al. 2018).Humans become infected by rabies-infected animals, and the virus finally invades the central nervous system (CNS)and then causes rabies symptoms (Davis et al. 2015).Once clinical signs are present, the mortality rate is almost 100%. Despite many years of research, the nature of rabies neuropathogenesis remains a mystery without deep explication, which has hindered the development of therapy for rabies (Mahadevan et al. 2016).

RABV, belonging to the genus Lyssavirus of the Rhabdoviridae family, can infect almost all warm-blooded animals. The RABV genome encodes five proteins:nucleoprotein (N), phosphoprotein (P), matrix protein (M),glycoprotein (G), and large polymerase protein (L) (Albertini et al. 2008). To date, at least four proteins, nicotinic acetylcholine receptor (nAChR) (Lentz et al. 1982), neural cell adhesion molecule (NCAM) (Thoulouze et al. 1998), lowaffinity nerve-growth factor receptor (p75NTR) (Tuffereau et al. 1998) and metabotropic glutamate receptor 2(mGluR2) (Wang et al. 2018) have been proposed to serve as receptors for RABV infection. However, many questions about the mechanism of RABV invasion and intracellular life cycle are very sophisticated and need further investigation.Actually, the street RABVs are not convenient enough to serve as model strain to investigate the mechanism of virus infection and development because of their high virulence and inadaptability to proliferate in vitro (Jackson 2007); the fixed or vaccine strains can be visualized only if they are labeled with further fluorescent antibodies or fluorescent dyes; and the recombinant RABVs expressing additional fluorescent proteins can be visualized only if enough fluorescent proteins have been accumulated as viruses replicate and multiply, resulting inability to be model RABVs to study the infection mechanism of early stage. Therefore,the development of self-fluorescence RABV model strain is of utmost importance and urgency.

The Evelyn-Rokitnicki-Abelseth (ERA) is a widely used rabies vaccine strain, and a popular RABV-vector platform for developing bivalent oral or inactive vaccines (Lawson et al. 1967; Shuai et al. 2015, 2017). In this study, we used reverse genetics to generate a recombinant RABV, rERA-N/mCherry, an additional N gene of ERA strain fused with the mCherry gene and harboring on the RABV genome. The feasibility of rERA-N/mCherry strain to serve as a visual viral model to track the RABV-cell binding and internalization was evaluated.

2. Materials and methods

2.1. Cells and viruses

Neuroblastoma (NA) and BSR cells were grown in Dulbecco’s Modified Eagle’s Minimal Essential Medium(DMEM, Gibco) supplemented with 10 or 5% fetal bovine serum (FBS, ExCell). The rERA strain was maintained in our laboratory (Shuai et al. 2015). All viruses were stored at -70°C before use.

2.2. Plasmid construction and virus rescue

The open reading frame of the ERA N gene (GenBank:GQ406343.1) and mCherry gene (GenBank: AY678264.1)were amplified with paired primers ENF/ENR (5′-GTC CCTCTAGAGTTTAAACATGAAAAAAACAGGCAACA CCACTGCCGCCACCATGGATGCCGACAAG-3′/5′-TTGCTCACCATTGAGTCACTCGAATATGTCT-3′) or EmCF/EmCR (5′-GAGTGACTCAATGGTGAGCAAGGGC-3′/5′-TTAGGACATCTCGGAGTTTAAACTTACTTGTACA GCTC-3′), and cloned into the PmeI site of pCI-rERA by using One Step Cloning Kit (Vazyme Biotech Co., Nanjing,China). The resultant plasmid was designated as pCIrERA-N/mCherry.

The protocols for the recombinant RABVs rescue were described previously (Tao et al. 2011). The positive viruses were screened from indirect immunofluorescence assays (IFAs), RT-PCR with paired primers NXF/NXR(5′-GATCCTCAGGGATACTCTTG-3′/5′-AGCCACAAGTC ATCGTCATC-3′), negative staining and observation by electron microscopy, and SDS-PAGE and brightein protien gel stain (US Everbright Inc., Suzhou, China) analyses (Ge et al. 2011; Wang et al. 2012), and used to propagate viral stocks in BSR cells. The rescued viruses were designated as rERA-N/mCherry.

2.3. Genetic stability and growth properties assays

To evaluate the genetic stability of the inserted gene of the rERA-N/mCherry strain, the viruses were serially passaged 15 times in NA cells (Tao et al. 2010). The viruses in different passages were examined by RT-PCR with paired primers NXF/NXR and titrated in BSR cells. The virus titers were expressed as focus-forming units (FFUs mL-1) by IFAs.

To examine the growth properties of viruses, 80%confluent BSR or NA cells monolayers grown in 6-well plates were infected with rERA or rERA-N/mCherry at a multiplicity of infection (MOI) of 0.1, washed twice with PBS (pH 7.4)and then supplied with DMEM containing 2% FBS. Viruses were harvested at 24-h intervals for 144 h post-inoculation,and respectively titrated in BSR or NA cells.

2.4. Mouse studies and laboratory facility

BALB/c mice (Vital River, Beijing, China) were handled in strict accordance with recommendations described in the Guide for the Care and Use of Laboratory Animals (Worlein et al. 2011), and approved by the Institutional Animal Care and Ethics Committee of Harbin Veterinary Research Institute (HVRI), Chinese Academy of Agricultural Sciences(CAAS). All mice were housed in cages, under controlled conditions of humidity, temperature, and light (12-h light/12-h dark cycles) in a biosafety level 3 facility at HVRI, CAAS.

2.5. Pathogenicity assessments

Groups of 6-week-old female BALB/c mice were incubated intracerebrally (i.c.) or intramuscularly (i.m.) with PBS containing 104FFU rERA-N/mCherry, and observed daily for signs of disease, bodyweight changes or death for 21 days.The PBS and rERA were used parallel. Meanwhile, the in vitro neurotropism index (NI) was assessed and expressed as the logarithm difference of the virus titers titrated in NA and BSR cells (Shuai et al. 2015).

2.6. Virus-cell binding and internalization

To monitor virus binding to the surface of cells, NA cell monolayers grown in 35-mm glass bottom dish were incubated with rERA-N/mCherry at a MOI of 10 for 1 h at 4°C, then fixed with pre-chilled 3% paraformaldehyde and stained with rabbit anti-clathrin antibody (ab21679,Abcam, Cambridge, UK) as the primary antibody, fluorescein isothiocyanate (FITC)-conjugated goat anti-rabbit IgG antibody (ab6717, Abcam) as the secondary antibody and hoechst 33342 (ab228551, Abcam) as cell nuclear dye.Stained cells were analyzed with a confocal laser scanning microscopy (LSM880, ZEISS). To observe internalization of virus into cells, the cells were incubated at 37°C for 20 min after incubation 1 h at 4°C. The cells without virus infection were used parallel.

2.7. Data analysis

Data were analyzed using GraphPad Prism Software(GraphPad Software Inc., San Diego, CA). The statistical analyses of the comparison between the results of assays were carried out using a paired Student’s t-test. For all tests,P-value＞0.05 was considered no statistically significant from a two-tailed analysis.

3. Result

3.1. Generation of the rERA-N/mCherry strain

The full-length viral genome plasmid was constructed(Fig. 1-A) and used to rescue the rERA-N/mCherry strain.The green fluorescence from IFAs and red self-fluorescence were observed under a confocal laser scanning microscopy(Fig. 1-B). In RT-PCR assays, amplified fragments of the rERA-N/mCherry or rERA strain with the expected sizes of 2 530 or 428 bp were obtained (Fig. 1-C). Besides, virions of the rERA-N/mCherry and rERA strain were observed using electron microscopy (Fig. 1-D), and RABV structural proteins were confirmed using SDS-PAGE and brightein protien gel stain (Fig. 1-E). As expected, the rERA-N/mCherry strain was rescued, and the inserted N/mCherry gene did not affect viral morphology and expression of RABV structural proteins.

3.2. The N/mCherry insertion has genetic stability and does not affect the growth properties of the ERA strain

In genetic stability assays, amplified fragments of rERA-N/mCherry or rERA strain with sizes of 2 530 or 428 bp were obtained in each passage of 15 passages, and consistent with the sizes of those from full-length viral genome plasmid pCI-rERA-N/mCherry or pCI-rERA (Fig. 2-A). Meanwhile,the green fluorescence from IFAs and red self-fluorescence of rERA-N/mCherry from each passage were found to be stably maintained (data not shown). Subsequently, the virus titers were determined in BSR cells, and reached approximately 7.9 lg FFU mL-1from the 5thto 15thpassage(Fig. 2-B).

In growth properties assays, rERA-N/mCherry and rERA reached peak titers of approximately 7.9 or 8 lg FFU mL-1in BSR cells (Fig. 2-C) and 8 or 8.2 lg FFU mL-1in NA cells(Fig. 2-D) at 96 h post-infection, respectively. The titers of rERA-N/mCherry were approximately 0.1 lg FFU mL-1lower in BSR cells and 0.2 lg FFU mL-1lower in NA cells than those of rERA but no significant difference at different time-points.

3.3. The N/mCherry expression does not increase the virulence of rERA

All of the mice remained healthy and had no significant difference in the body weight changes between rERA-N/mCherry- and rERA-i.m. inoculation groups during the observation period (Fig. 3-A). Furthermore, the death pattern and the survivorship were similar and had no significant difference both in rERA-N/mCherry- and rERAi.c. inoculation mice (Fig. 3-B). Meanwhile, the in vitro neurotropism index (NI) of rERA-N/mCherry and rERA were 0.14 and 0.26, respectively (Table 1).

3.4. Self-fluorescence of rERA-N/mCherry displaying the RABV-cell binding and internalization

Fig. 1 Generation of the recombinant rabies virus (RABV) expressing N/mCherry gene. A, schematic representation showing the genome of a recombinant RABV Evelyn-Rokitnicki-Abelseth strain (rERA) with the PmeI site introduced between the P and M genes,and rERA vector expressing an additional ERA nucleoprotein that fuses a red fluorescent protein (N/mCherry). B, self-fluorescent and indirect immunofluorescence analyses of the recombinant RABV. BSR cells infected with the recombinant RABV or vector at a multiplicity of infection (MOI) of 0.1 were incubated with dog anti-RABV serum at 48 h post-infection, and then incubated with an FITC-conjugated rabbit anti-dog antibody. Cells were observed with a confocal laser microscope for the vector and mCherry identification. C, confirmation of the recovery of the rERA-N/mCherry strain with paired primers NXF/NXR by RT-PCR. RT-PCR products of the rERA strain (lane 1, 428 bp) and the recovered rERA-N/mCherry strain (lane 2, 2 530 bp) were electrophoresed through a 1% agarose gel. NC, negative control. D, the rERA and rERA-N/mCherry strains were grown in BSR cells, and the viral supernatants were pelleted by ultracentrifugation and suspended in PBS (pH 7.4). The rERA and rERA-N/mCherry virions were negatively stained and observed by electron microscopy. E, SDS-PAGES analyses of the recombinant RABV. Proteins from the the rERA or rERA-N/mCherry virions were separated by using SDS-10% PAGE under denaturing conditions and electrophoresed through a 10% polyacrylamide gel. Staining was performed using brightein protien gel stain (US Everbright Inc., Suzhou, China)and visualized with the Odyssey Infrared Imaging System (LI-COR Biosciences, Nebraska, USA).

In RABV-cell binding assays, typical red dots of the rERA-N/mCherry strain could be visualized exclusively at the surface of cells by a confocal laser scanning microscop, and were less than 1 μm (Fig. 4-A). However, these dots were not present in parallel mock-incubated cells (Fig. 4-C). In RABV-cell internalization assays, as expected, the red dots colocalized with clathrin were found internalized into cells (Fig. 4-B). Obviously, the red dots represent the temperature-dependent binding and internalization to/into cells of fluorescent virions, which is consistent with the receptor-mediated binding and endocytosis of natural RABV described previously.

4. Discussion

Fig. 2 Genetic stability and growth characteristics of a recombinant RABV Evelyn-Rokitnicki-Abelseth (rERA)-N/mCherry strains.A, the rERA-N/mCherry strain was serially passaged 15 times in neuroblastoma (NA) cells, and the viral genome RNAs individually isolated from each passage were respectively used as templates to perform RT-PCR with paired primers NXF/NXR. RT-PCR products of the rERA strain (lane 1, 428 bp) and the 1st to 15th passage of rERA-N/mCherry strain (lane 2 to 16, 2 530 bp) were electrophoresed through a 1% agarose gel, respectively. The full-length cDNA pCI-rERA (lane 17), pCI-rERA-N/mCherry (lane 18), plasmid vector pCI (lane 19) and ddH2O (lane 20) were performed PCR as controls and were processed in parallel. B, the rERA-N/mCherry titers of each passage were determined in BSR cells and expressed as focus-forming units (FFU) mL-1 by indirect immunofluorescence assay (IFA). C and D, BSR and NA cell monolayers were infected with rERA and rERA-N/mCherry at a MOI of 0.1, respectively. Viruses were harvested at 24 h intervals and flash frozen in 70°C. The virus titers were determined in BSR cells and expressed as FFU mL-1. The data shown are the mean±SD of four independent experiments. Significant differences of all time points between the rERA and rERA-N/mCherry were assessed by using the Student’s t-test.

Rabies is a fatal zoonotic disease caused by RABV, which is still a serious threat to human public health (Minghui et al.2018). Due to the limited understanding of the mechanism of RABV infection and development, there is still no effective treatment for the disease. It is known that RABV invades the host cell via receptor-mediated endocytosis, low pHdependent fusion and the clathrin-mediated internalization(Lewis and Lentz 1998; Gaudin 2000; Roche and Gaudin 2004; Piccinotti et al. 2013). Actually, RABV may use different receptors during the journey of invading to the CNS. Obviously, the fundamental molecular mechanism of RABV-receptors interaction, internalization, and the eventual development of neurological symptoms is not yet fully understood. Consequently, an effective RABV model needs to be developed to facilitate a further understanding of the mechanism.

In this study, we generated a recombinant RABV strain,rERA-N/mCherry, based on a rabies vaccine strain rERA.Compared with the parent rERA strain, the rERA-N/mCherry strain has the live and integral RABV strain with similar biological characteristics including production convenience in vitro, genetic stability, morphology, composition and virulence, etc. Due to the advantage of red self-fluorescence of the rERA-N/mCherry strain, the RABV particles binding to cell membrane and subsequent internalization into cells via well-known clathrin-dependent pathway (Piccinotti and Whelan 2016) were monitored directly under a fluorescence microscopy, indicating that this recombinant RABV strain was a good alternative model to further investigate the infection mechanism of authentic RABV.

Fig. 3 Pathogenicity evaluation of the a recombinant RABV Evelyn-Rokitnicki-Abelseth (rERA)-N/mCherry strain. Groups of ten 6-week old female BALB/c mice were inoculated intracerebrally (i.c.) with 0.03 mL PBS containing 104 focusforming units (FFU) or intramuscularly (i.m.) with 0.1 mL PBS containing 104 FFU recombinant RABV or vector. The weight changes (A) and survivals (B) of mice were monitored daily for 21 days. Body weight changes for groups indicated are shown as ratios of the body weight at day 0, which was set as 100. Significant differences of survival rate and body weight changes between the rERA and rERA-N/mCherry inoculated groups were assessed by using the Student’s t-test.

The imaging study has developed into an effective method to investigate the viral infection mechanism including the entry pathway and intracellular transport, and also has the potential to be widely applied for RABV research. Obviously,it is evident that viral infections are complex processes,and the development of virus particle imaging is helpful to understand the infection process of virus accurately (Greber and Way 2006; Boulant et al. 2015). To successfully image virus particles, the virus and cellular structures of interest labeled with fluorescent tags are as important as highresolution microscopic techniques (Sun et al. 2013). For many years, fluorescent dyes (FDs) (Carette et al. 2011;Xu et al. 2015) or fluorescent proteins (FPs) (Betzig et al.2006; Takeuchi and Ozawa 2007) are actually used most often in viral labeling due to factors such as photostability,high signal to noise ratios and low interference between tags by different spectra. For decreasing the noise of the signal, FDs should be co-incubated hours with purified viruses and then washed times to remove excess dye(van der Schaar et al. 2008). Conveniently, the FPs are commonly expressed by inserting FP genes into the viral genomes or fusing FP genes into a structural protein gene of viruses. RABVs with inserted FP genes can be captured by a fluorescent microscope only when the FPs are expressed enough along with the viruses replicate and multiply, which determines the RABVs unsuitable for studying the infection mechanism of early stage (Piccinotti et al. 2013). Whereas,no obstacle exists for early infection study in RABVs with fused FP genes due to the viral structural proteins fused with FPs can be captured by fluorescence microscopy directly. Therefore, the structural protein of the RABVs integrated FPs genetically can be widely used for exploring the molecular mechanism of rabies infection.

Table 1 Neurotropism index of the recombinant RABV Evelyn-Rokitnicki-Abelseth (rERA) and rERA-N/mCherry strains in NA and BSR cells

N protein of RABVs, the most conserved of the viral proteins among the lyssaviruses, is the key protein to form the core of the bullet-shaped virion and the active viral replication unit in the RABV life cycle. Here, with the replication and translation of the rERA-N/mCherry strain,the N protein and a red FP are stably expressed by fusion and co-packaged into the RABV particles. Hence, the red FP, whether from the viral particles or accumulate as the viruses replicate and multiply, can be captured by fluorescence microscopy. It is worth noting that, while this manuscript is being prepared, the rERA-N/mCherry strain has assisted to demonstrate a new receptor for RABV infection (Wang et al. 2018), indicated that the rERA-N/mCherry strain has the potential to be a model to study the various stages of RABV infection, including the early invasion and late budding, even the fundamental molecular mechanism of rabies.

Fig. 4 The recombinant RABV Evelyn-Rokitnicki-Abelseth (rERA)-N/mCherry particles binding to cell membrane and internalization via clathrin. Neuroblastoma (NA) cells were infected with rERA-N/mCherry for 1 h at 4°C (A), or 20 min at 37°C after infection at 37°C for 1 h (B), and stained by indirect immunofluorescence assay (IFA) assays. NA cells with no virus-infection were served as controls and processed in parallel (C). RABV antigens (red), immunofluorescence-stained clathrin (green) and cell nucleis (blue)were performed in single fluorescence channels. The images on the right side (A and B) represent amplified random binding or co-localization spots within the small white box. RABV antigens indicated with the white arrowhead were assembled on the surface of cells (A) or co-located with clathrin inside of the cells (B).

The FPs-tagged single virions accompany with advances in microscopy engineering and image analyses has been conducive to track single particle and reveal the facts that virions initial contacts with receptors on the plasma membrane, then move inside of the cell in quasi two-dimensional diffusive motions and last cell-to-cell transmission (Brandenburg and Zhuang 2007; Burckhardt and Greber 2009; Mothes et al. 2010). To fulfill the evaluation on rERA-N/mCherry served as a visual viral model to study the infection mechanism of RABV, we will extend our study to single particle tracking experiments.Of course, these studies will include particle detection under ultra-high resolution microscope, tracking, trajectory classification and physical modeling (Helmuth et al. 2007).

Acknowledgements

This work was supported by the National Natural Science Fundation of China (31800138) and the National Key Research and Development Program of China(2016YFD0500403).