Effects of Scutellaria Baicalensis on Activity and Biofilm Formation of Klebsiella Pneumoniae△

Wei Chen， Bei Li， Shuai Li， Yi-wen Ou， and Qin Ou*

1The First School of Clinical Medicine，2Department of Medical Microbiology，Hubei University of Medicine， Shiyan City， Hubei 442000， China

?

Effects of Scutellaria Baicalensis on Activity and Biofilm Formation of Klebsiella Pneumoniae△

Wei Chen1， Bei Li2， Shuai Li1， Yi-wen Ou1， and Qin Ou2*

1The First School of Clinical Medicine，2Department of Medical Microbiology，Hubei University of Medicine， Shiyan City， Hubei 442000， China

Scutellaria baicalensis； klebsiella pneumoniae； biofilm formation；integron geneⅠ1

Objective To explore the effects of Scutellaria baicalensis on activity and biofilm formation of Klebsiella pneumonia （Kp）.

Methods The broth and agar dilution methods were carried out to determine minimum inhibitory concentration and minimum bactericidal concentration of Scutellaria baicalensis for TW518. VITEK-32 system was used to assay TW518 susceptibility to antibiotics. Kp biofilms were formed in vitro and stained with BacLight Live/Dead stain. The class integron geneⅠ1 mRNA expression was analyzed with RT-PCR.

Results The minimum inhibitory concentration of Scutellaria baicalensis on TW518 identified as a Kp colony was 32 mg/ml， and minimum bactericidal concentration was 64 mg/ml. Scutellaria baicalensis and broad-spectrum penicillin， cephalosporin， quinolones， or beta-lactamase had synergistic bactericidal effects. Biofilm formation activity of Kp treated with Scutellaria baicalensis was significantly lower than that of the control group. And class integron geneⅠ1 mRNA expression of TW518 was significantly inhibited by Scutellaria baicalensis.

Conclusions Scutellaria baicalensis has sterilization effect on Kp， and Scutellaria baicalensis could effectively inhibit Kp biofilm formation with prolonged treatment. Scutellaria baicalensis might inhibit Kp biofilm formation through down-regulating integron geneⅠ1 expression.

Chin Med Sci J 2016； 31（3）：180-184

K LEBSIELLA pneumoniae （Kp） is a kind of gramnegative bacillus and a normal component of the host flora in human upper respiratory tract and intestinal tract. Meanwhile， Kp is one of the most important pathogenic bacteria of community acquired infections and hospital infections.1Kp could cause a typical primary pneumonia， liver abscess， purulent meningitis and other serious diseases such as urinary tract infection.2For the evolution and movement of antibiotic resistance genes over the last 20 years， multidrug resistant Kp is still increasing and strongly threatening the people's lives.3

Biofilm formation （BF） on bacterial surfaces has been shown to greatly assist bacteria drug resistance.4Rahim et al5suggested that the biofilm growth significantly promotedbacterial resistance to some antibiotics than the planktonic growth.5A reduced growth rate of the bacteria and the active starvation response， as well as changes in bacterial gene expression in the biofilm mode of growth could contribute to BF.6Tan et al7found a novel chemosynthetic peptide could efficiently kill Kp through inhibiting Kp BF.7

Scutellaria baicalensis has been used for auxiliary treatment of infectious disease.8For its strong antimicrobial properties， fewer side effects， being not easy to produce multiple drug resistance， Scutellaria baicalensis might be a new option to solve the increasingly serious bacterial resistance.9In this study， we explored the effects of Scutellaria baicalensis on the activity and BF of Kp.

MATERIALS AND METHODS

Identification and extraction of Scutellaria baicalensis

Scutellaria baicalensis was bought from Institute of Traditional Chinese Medicine of Taihe Hospital in Shiyan City，Hubei Province. Scutellaria baicalensis was identified by the special herbalists in this hospital. Scutellaria baicalensis 200 g soaked in 400 ml double distilled H2O was boiled for 30 minutes， followed by decoction at a simmer for 30 minutes， and finally was filtered. Then the herb was decocted the second time in 300 ml double distilled H2O for 30 minutes and filtered. The two filtrates were concentrated to a final concentration of 1 g/ml. The high-pressure sterilized Scutellaria baicalensis extract was then aliquoted into individual 20 ml volume， and stored at -20°C.

Antibacterial activities of Scutellaria baicalensis

Kp strain NTUH-K2044 （TW518） was kindly gifted by Dong-sheng Zhou （Academy of Military Medical Sciences，Beijing， China）. The broth and agar dilution methods were carried out in triplicate to determine minimum inhibitory concentration （MIC） and minimum bactericidal concentration （MBC） of Scutellaria baicalensis for TW518.10

Bacterial susceptibility test

The fresh TW518 colony was suspended in culture medium and bacterial suspension was diluted to get an OD600 of 0.5. Sequentially， bacterial suspension was seeded into the culture plate supplemented with antibiotics and incubated at 35°C.

VITEK-32 automatic microbial identification/drug susceptibility analysis system （BioMerieux， France） was used to evaluate the bacterial susceptibility. The pathogen's antimicrobial susceptibility to ampicillin （AMP）， piperacillin（PRL）， ampicillin/sulbactam （SAM）， piperacillin/tazobactam（TZP）， cefoperazone/sulbactam （SCF）， amoxicillin/clavulanic acid （AMC）， cefazolin （KZ）， cefuroxime （CXM）， cefoxitin（FOX）， cefotaxime （CTX）， ceftriaxone （CRO）， ceftazidime（CAZ）， cefepime （FEP）， meropenem （MER）， imipenem（IMP）， amikacin （AK）， gentamicin （GM）， tetracycline （TE），minocycline （MI）， and ciprofloxacin （CIP）， levofloxacin（LEV）， aztreonam （AZT） was determined， respectively. The experiments were repeated three times.

To investigate the synergistic bactericidal effect of Scutellaria baicalensis combined with antibiotics， TW518 was exposed to the antibiotics plus 1/2， 1/4， 1/8 and 1/16 MIC of Scutellaria baicalensis respectively.

In vitro Kp biofilm formation and Scutellaria baicalensis against biofilm formation

We established Kp biofilm model according to the method described by Diago-Navarro.11Briefly， an overnight-culture Kp colony was suspended in culture medium and bacterial suspension was diluted to get an OD600 of 1.0. The resulting bacterial suspension was diluted 1：100 （10 μl bacterial suspension+1 ml culture medium） and incubated in pre-sterilizated 24-well plate with cover glass at 37°C with 5% CO2. The culture medium was changed every day. The biofilms were stained with the BacLight Live/Dead stain（Life Technologies） following the manufacturer guidelines and examined using a confocal laser microscope to characterize the biofilm structure under varying incubation conditions. The live bacteria stained with SYTO9 exhibit green fluorescent， and the dead bacteria labeled by PI emit red fluorescent.

To analyze the inhibiting effect of Scutellaria baicalensis on biofilm formation， the Kp stain grown on 24-well plate was divided into the control group which was only incubated with culture medium， and 1/2， 1/4， 1/8 and 1/16 MIC of Scutellaria baicalensis groups respectively. Quadruple samples were used in all experiments and each experiment was repeated three times. After aerobical incubation at 37°C in order to produce biofilm， Scutellaria baicalensis was added separately and incubated for 1， 3，and 7 days， and biofilms were stained with the BacLight Live/Dead stain.

RNA extraction and RT-PCR

Class integron gene Ⅰ plays important roles in Kp growth and biofilm formation. We tried to test class integron geneⅠ1 expression of Kp after treatment with different concentrations of Scutellaria baicalensis. Kp in the control and 1/2， 1/4， 1/8， and 1/16 MIC Scutellaria baicalensis groups treated with the drug for 3 days were separately collectedfor RT-PCR analysis. The total RNA was isolated using TRIzol reagent （Invitrogen）. Primers of class integron geneⅠ1 and 16sRNA （internal control） were synthesized by Shengong Bio. （Shanghai， China）. The primer sequences for integron gene Ⅰ1 were as follows： forward 5'CCTCCC GCACGATGATCGTGCC3' and reverse 5'CGGTCTCCACGCAT CGTCAGGC3'. The primer sequences for 16sRNA were：forward 5'AGGCCTAACACATGCAAGTC3' and reverse 5'GT CAATCGCCAAGGTTATTA3'. PCR was performed in a DNA thermal cycler （Applied Biosystems， CA， USA） under the following conditions： one cycle at 94°C for 4 minutes； 26 cycles， at 94°C for 30 seconds， at 55°C for 30 seconds， and at 72°C for 45 seconds； and one cycle at 72°C for 10 minutes.

Statistical analysis

SPSS 17.0 software was used for data analysis. The measurement data were calculated and expressed as mean±standard deviation. T-test was adopted to compare the difference between two groups. P＜0.05 was regarded as statistically significant.

RESULTS

MIC and MBC of Scutellaria baicalensis

MIC and MBC of Scutellaria baicalensis extract for TW518 were 32±2.2 mg/ml and 64±3.6 mg/ml， respectively.

Antibacterial activities of Scutellaria baicalensis

TW518 was identified as Kp. For the control groups， TW518 was susceptible to TZP， FOX， SCF， FEP， MEC， IMP， AK， GM，TE， MI， and CIP. For all the experimental groups， Scutellaria baicalensis could enhance the sensitivity of TW518 to antibiotics KZ， CXM， CTX， CRO， CAZ and LEV. The 1/2， 1/4 and 1/8 MIC Scutellaria baicalensis could increase the antibacterial activities of AMC and AZT against TW518， and 1/2 MIC Scutellaria baicalensis could elevate the susceptibility of TW518 to antibiotics PRL.

Scutellaria baicalensis inhibits BF of Kp

As showed in Fig. 1， after 1 and 3 days exposure to Scutellaria baicalensis， number of green fluorescence stained bacterial cells was decreased with the increasing concentration of Scutellaria baicalensis. And no obvious red fluorescence could be observed in all the groups， indicating most of the bacteria were impermeable to PI. Following 7 days incubation with Scutellaria baicalensis， confocal laser microscopy revealed Kp colonies of the control group and 1/16 MIC Scutellaria baicalensis group formed thick and dense green fluorescent biofilms structure and a small amount of red fluorescence could be observed. Compared to the control group， however， 1/2 MIC Scutellaria baicalensis group formed sparse biofilms with markedly decreased green fluorescence and obviously increased red fluorescence.

Scutellaria baicalensis inhibiting bi ofilm relate d gene class integron gene Ⅰ1 expression of Kp

No significant expression difference of integron gene Ⅰ1 mRNA was observed between the control group and 1/16 MIC Scutellaria baicalensis group （1.10±0.15 vs. 1.01±0.10，P＞0.05）. Compared to the control group， however， 1/4（0.68±0.06）， 1/8 （0.74±0.08）， and 1/2 MIC Scutellaria baicalensis （0.32±0.04） could significantly inhibit integron gene Ⅰ1 mRNA expression （all P＜0.05）.

DISCUSSION

Antibiotic resistance is an increasingly serious clinical problem. Especially， the infections caused by generic drug resistant and multidrug-resistant bacteria are a serious threat to the healthcare system.12The use and misuse of antibiotics in farm animal settings to promote more productive farm animals or to prevent nonspecific infection has resulted in antibiotic resistance among bacteria.13Therefore， it is important to find a new treatment modality for infectious disease.

Kp was isolated for the first time in 1882 by Friedlander from the lung tissues of patients who died of pneumonia. This encapsulated bacterium， initially named Friedlander's bacillus， was renamed Klebsiella in 1886.14It could not only cause the human gastrointestinal tract，skin， nasopharynx， urinary and biliary tract infections， but also correlated with osteomyelitis and bacteremia.5Hospital outbreaks of Kp in Europea have been increasingly reported.15，16

Scutellaria baicalensis is effective as an auxiliary treatment drug for infectious diseases in China. The dry roots of Scutellaria baicalensis are widely used to cure the upper respiratory tract infection， urinary tract infection，bacillary dysentery， and hepatitis owing to its detoxification capability.17Numerous studies reported Scutellaria baicalensis could play anticancer activity through its bacteriostasis and anti-inflammatory effects.18，19In the present study， we confirmed that Scutellaria baicalensis could obviously inhibit Kp growth with MIC of 32±2.2 mg/ml and MBC of 64±3.6 mg/ml， respectively， which demonstrated that Scutellaria baicalensis had excellent antibacterial effect on Kp.20

Figure 1. Scutellaria baicalensis treatment inhibits biofilm formation of Klebsiella pneumoniae. ×200 Klebsiella pneumoniae was grown without any treatment or was treated with the indicated concentrations of Scutellaria baicalensis for 1， 3， and 7 days separately. The biofilm formation of the strain tested was observed under a confocal laser microscope. Green fluorescent bacterial cells are viable， whereas red fluorescent bacteria are dead. MIC： minimum inhibitory concentration.

A biofilm is initially formed by a group of bacteria in which cells adhere to each or a surface. If the colonists are not immediately separated from the surface， they can anchor themselves permanently to make up of membrane structure. After BF， bacteria could express some special genes different from planktonic bacteria to form a new phenotypes.21BF has been regarded to have great impact on antibiotic resistance.22Through slow release of planktonic bacteria into the surrounding tissues， BF becomes a potential source of infection and cause chronic persistent infection or recurrent infection.23Obviously， antimicrobial susceptibility could be effectively increased through inhibiting bacterial BF.24，25Our study showed that 1/2 MIC Scutellaria baicalensis could inhibit Kp BF. Therefore，Scutellaria baicalensis might been used for Kp chronic infection disease therapy through preventing Kp BF.

Class integron gene Ⅰ plays important roles in Kp bacterial growth and BF.26，27And integron gene Ⅰ1 is involved in bacterial BF.28Our results indicated that 1/4， 1/8 and 1/2 MIC Scutellaria baicalensis inhibited Kp integron gene Ⅰ1 expression. These results suggested that Scutellaria baicalensis might inhibit Kp BF partly through inhibiting integron geneⅠ1 expression.

In conclusion， Scutellaria baicalensis and antibiotics had the synergistic bactericidal effect on Kp. Scutellaria baicalensise might inhibit Kp BF through down-regulating integron gene Ⅰ1 expression.

REFERENCES

1. Rath S， Padhy RN. Prevalence of two multidrug resistant Klebsiella species in an Indian teaching hospital and ad-joining community. J Infect Public Health 2014； 7：496-507.

2. Yan JJ， Wang MC， Zheng PX， et al. Associations of the major international high-risk resistant clones and virulent clones with specific ompK36 allele groups in Klebsiella pneumoniae in Taiwan. New Microbes New Infect 2015；5：1-4.

3. Hawkey PM. Multidrug resistant gram-negative bacteria： a product of globalization. J Hosp Infect 2015； 89：241-7.

4. Jang CH， Park H， Cho YB， et al. Effect of vancomycin-coated tympanostomy tubes on methicillin-resistant Staphylococcus aureus biofilms formation： in vitro study. J Laryngol Otol 2014； 124：594-8.

5. Rahim K， Qasim M， Rahman H， et al. Antimicrobial resistance among aerobic biofilm producing bacteria isolated from chronic wounds in the tertiary care hospitals of Peshawar， Pakistan. J Wound Care 2016； 25：480-6.

6. Hola V，Ruzicka F. Urinary catheter biofilms infections. Epidemiol Mikrobio Imunol 2008； 7：47-52.

7. Tan S， Gan C， Li R， et al. A novel chemosynthetic peptide with β-sheet motif efficiently kills Klebsiella pneumoniae in a mouse model. Int J Nanomedicine 2015； 9：1045-59.

8. Guo M， Cao Y， Wang T， et al. Baicalin inhibits Staphylococcus aureus-induced apoptosis by regulating TLR2 and TLR2-related apoptotic factors in the mouse mammary glands. Eur J Pharmacol 2014； 723：481-8.

9. Wang MH， Li LZ， Sun JB， et al. A new antioxidant flavone glycoside from Scutellaria baicalensis Georgi. Nat Rrod Res 2014； 28：1772-6.

10. Igawa G， Casey M， Sawabe E， et al. Comparison of agar dilution and broth microdilution methods for Clostridium difficile antimicrobial susceptibility testing. J Glob Antimicrob Resist 2016； 7：43-5.

11. Diago-Navarro E， Chen L， Passet V， et al. Carbapenemresistant Klebsiella pneumoniae exhibit variability in capsular polysaccharide and capsule associated virulence traits. J Infect Dis 2014； 210：803-13.

12. Vasoo S， Barreto JN， Tosh PK. Emerging issues in gram-negative bacterial resistance： an update for the practicing clinician. Mayo Clin Proc 2015； 90：395-403.

13. Economou V， Gousia P. Agriculture and food animals as a source of antimicrobial-resistant bacteria. Infect Drug Resist 2015； 8：49-61.

14. Podschun R， Ullmann U. Klebsiella spp. as nosocomial pathogens： epidemiology， taxonomy， typing methods， and pathogenicity factors. Clin Microbiol Rev 1998； 11：589-603.

15. Kola A， Poening B， Pape UF， et al. An outbreak of carbapenem-resistant OXA-48-producing Klebsiella pneumonia associated to duodenoscopy. Antimicrob Resist Infect Control 2015； 4：8.

16. Wrenn C， OBrien D， Keating D， et al. Investigation of the first outbreak of OXA-48-producing Klebsiella pneumoniae in Ireland. J Hosp Infect 2014， 87：41-6.

17. Yuan Y， Shuai L， Chen S， et al. Flavonoids and antioxidative enzymes in temperature-challenged roots of Scutellaria baicalensis Georgi. Z Naturforsch C 2014； 67：77-85.

18. Peng Y， Guo CS， Li PX， et al. Immune and anti-oxidant functions of ethanol extracts of Scutellaria baicalensis Georgi in mice bearing U14 cervical cancers. Asian Pac J Cancer Prev 2014； 15：4129-33.

19. Ma GZ， Liu CH， Wei B， et al. Baicalein inhibits DMBA/ TPA-induced skin tumorigenesis in mice by modulating proliferation， apoptosis， and inflammation. Inflammation 2013； 36：457-67.

20. Chan BC， Ip M， Lau CB， et al. Synergistic effects of baicalein with ciprofloxacin against NorA over-expressed methicillin-resistant Staphylococcus aureus （MRSA） and inhibition of MRSA pyruvate kinase. J Ethnopharmacol 2011； 137：767-73.

21. Loughran AJ， Atwood DN， Anthony AC， et al. Impact of individual extracellular proteases on Staphylococcus aureus biofilms formation in diverse clinical isolates and their isogenic sarA mutants. Microbiologyopen 2014； 3：897-909.

22. Johnson JG， Murphy CN， Sippy J， et al.Type 3 fimbriae and biofilms formation are regulated by the transcriptional regulators MrkHI in Klebsiella pneumonia. J Baceriol 2011；193：3453-60.

23. Naparstek L， Carmeli Y， Navon-Venezia S， et al. Biofilms formation and susceptibility to gentamicin and colistin of extremely drug-resistant KPC-producing Klebsiella pneumoniae. J Antimicrob Chemother 2014； 69：1027-34.

24. Rao S， Sharma G， Bansal A， et al. Pseudomonas aeruginosa biofilms： potential therapeutic targets. Biologicals 2014； 42：1-7.

25. Silva PV， Silva PV， Keim LS， et al. The antimicrobial susceptibility， biofilms formation and genotypic profiles of Staphylococcus haemelyticus from bloodstream infections. Mem Inst Oswaldo Cruz 2013； 108：812-3.

26. Nikokar I， Tishayar A， Flakiyan Z， et al. Antibiotic resistance and frequency of class 1 integrons among Pseudomonasaerugi nosa， isolated from burn patients in Guilan， Iran. Iran J Microbiol 2013； 5：36-41.

27. Shin HW， Lim J， Kim S， et al. Characterization of trimethoprim-sulfamethoxazole resistance genes and their relatedness to class 1 integron and insertion sequence common region in gram-negative bacilli. J Microbiol Biotechnol 2015； 25：137-42.

28. Yang WQ， Shi L， Cheng X， et al. Quantification of class 1 integrase gene expression of Pseudomonas aeruginosa in biofilm. Sichuan Da Xue Xue Bao Yi Xue Ban 2007； 38：565-8.

for publication October 28， 2015.

Tel： 86-719-8891151， E-mail： 151449176@qq.com

△Supported by the Fund of Hubei 2011 Cooperative Innovation Center and proje ct f or College Stud ents Inno vation an d Entrepreneur ship（Grant 4）， Hubei University of Medicine （201310929004）.