Anti-encystment and amoebicidal activity of Lonicera japonica Thunb. and its major constituent Chlorogenic acid in vitro

Tooba Mahboob， Abdul-Majid Azlan， Tian-Chye Tan， Chandramathi Samudi， Shamala Devi Sekaran， Veeranoot Nissapatorn?， Christophe Wiart

1Department of Parasitology， Faculty of Medicine， University of Malaya， 50603 Kuala Lumpur， Malaysia

2Department of Medical Microbiology， Faculty of Medicine， University of Malaya， 50603 Kuala Lumpur， Malaysia

3School of Pharmacy， University of Nottingham Malaysia Campus， Jalan 56000 Semenyih， Kuala Lumpur， Malaysia

Anti-encystment and amoebicidal activity of Lonicera japonica Thunb. and its major constituent Chlorogenic acid in vitro

Tooba Mahboob1， Abdul-Majid Azlan1， Tian-Chye Tan1， Chandramathi Samudi2， Shamala Devi Sekaran2， Veeranoot Nissapatorn1?， Christophe Wiart3

1Department of Parasitology， Faculty of Medicine， University of Malaya， 50603 Kuala Lumpur， Malaysia

2Department of Medical Microbiology， Faculty of Medicine， University of Malaya， 50603 Kuala Lumpur， Malaysia

3School of Pharmacy， University of Nottingham Malaysia Campus， Jalan 56000 Semenyih， Kuala Lumpur， Malaysia

ARTICLE INFO

Article history:

Received 15 May 2016

Received in revised form 16 June 2016

Accepted 1 July 2016

Available online 20 September 2016

Acanthamoeba spp.

Amoebicidal

Chlorogenic acid

Encystment

Lonicera japonica Thunb.

Objective: To examine the acanthamoebicidal ef f ects of ethyl acetate， aqueous and butanol fractions of dried fl ower buds of Lonicera japonica （L. japonica） Thunb. （Flos Lonicerae） in vitro. Methods: Acanthamoeba triangularis isolates were obtained from environmental water samples and identif i ed by PCR. They were exposed to ethyl acetate， water and butanol fractions of L. japonica Thunb. at concentrations ranging from 0.5 mg/mL to 1.5 mg/mL. The extracts were evaluated for growth inhibition at 24， 48 and 72 h， respectively. Chlorogenic acid at a concentration of 1 mg/mL was examined for inhibition of encystment. Results: Ethyl acetate fraction at a concentration of 1.5 mg/mL evoked a signif i cant reduction of trophozoite viability by 48.9% after 24 h， 49.2% after 48 h and 33.7% after 72 h Chlorogenic acid， the major active constituent of L. japonica Thunb. at the concentration of 1 mg/mL reduced the cysts/trophozoite ratio by 100% after 24 h， 84.0% after 48 h and 72.3% after 72 h. This phenolic compound at concentration of 1 mg/mL concurrent with 0.6% hydrogen peroxide inhibited hydrogen peroxide-induced encystment by 92.8% at 72 h. Conclusions: Results obtained from this study show that ethyl acetate fraction at 1.5 mg/mL is the most potent fraction of L. japonica Thunb. and its major constituent chlorogenic acid showed the remarkable inhibition of encystment at a concentration of 1 mg/mL.

1. Introduction

Acanthamoeba is one of the most important related human pathogenic free living amoeba. Members of the genus Acanthamoeba Volkonsky， discovered in 1931， are protozoa living in soil， dust， water， sand， humidifiers， air conditioning units，contact lens and hospital facilities［1］. Some species in this genus are human pathogens［2］， for instance Acanthameoba polyphaga and Acanthamoeba triangularis （A. triangularis） which account for ophthalmic and cutaneous keratitis as well as granulomatous encephalitis［3］. Granulomatous amoebic encephalitis （GAE） is associated with immunosuppression and is usually fatal［4］. Treating acanthamoebiasis is diffi cult as there have been constant reports on the resistance to biocides， lack of nutrients or unfavorable temperature or osmolarity trigger within 24 to 48 h phenotype modification from vegetative trophozoites to cryptobiotic multiresistant cysts［5］. So far， there is no clear evidence of the complete molecular pathways commanding encystment but some recent studies suggest the participation of reactive oxygen species as well as a variation in redox state in the protozoa［6］. Evidence for theability of medicinal plants to abrogate the survival of trophozoites and cysts in vitro has been accumulating. Among the pathogenic free living amoebae， A. triangularis shows typical morphological characteristics of group II in the genus Acanthamoeba that has been classif i ed for the past 40 years［7］. A. triangularis has a double walled cyst which consists of thick wrinkled ectocyst and satellite or polygonal endocyst. The cyst diameter is between 12.0 and 22.5 μm and with （3-6） arms［8］.

As part of an ongoing study to isolate novel chemopreventive or therapeutic compounds from Asian medicinal plants， we， therefore focused on the flower buds of Lonicera japonica （L. japonica）Thunb. or ‘Jin Yin Hua’ which are used externally in the form of water decoction for the treatment of acute conjunctivitis in traditional Chinese medicine［9］. Since conjunctivitis is a symptom of Acanthamoebiasis， we prepared extracts in solvents of dif f erent polarity， from the dried fl ower buds of L. japonica Thunb for their ability to inhibit the growth of trophozoites， cysts and encystment of A. triangularis in vitro. In the literature， studies demonstrate that extracts of flowers buds of L. japonica Thunb. inhibit TNFα in lipopolysaccharide-stimulated RAW 264.7 macrophages［10］lower glycemia［11］ and possess antioxidant properties on account of its major constituent chlorogenic acid［12］. Chlorogenic acid is one of the most abundant phenolic compounds in the fl ower buds for L. japonica. This conjugate of caffeic acid and quinic acid is produced by few plant species including Coffea arabica， Artemisia iwayomogi and Calstilloa elastica. Some evidence demonstrates that chlorogenic acid is antioxidant， antibacterial， anticarcinogenic，particularly hypoglycemic and hypolipidemic［13］. To date， no study on acanthamoebicidal activity on L. japonica Thunb. and its major constituent chlorogenic acid has been reported against pathogenic Acanthamoeba spp.

2. Materials and methods

2.1. Plant material and extraction

Dried flower buds of L. japonica Thunb. were purchased from a local Chinese medicinal store in Kuala Lumpur， Malaysia and were deposited in the herbarium of the University of Malaya with the voucher number KLU 47693. A total of 650 grams （g）of the powdered plant material was soaked with absolute ethanol at room temperature for 7 days. The tincture was filtered and evaporated to obtain a dark brown mass. The dried ethanol extract was resuspended in water and the aqueous phase was defatted with hexane and successively extracted with ethylacetate and butanol. Upon evaporation， 0.5 g of ethyl acetate， 3 g of butanol and 11.3 g of aqueous fractions were obtained， kept in air tight containers and stored in a refrigerator until use.

2.2. Acanthamoeba cultivation on non-nutrient agar （NNA）

Positive environmental water samples were obtained from Department of Parasitology， Faculty of Medicine， University of Malaya. The water samples were concentrated. Parasites were cultured onto non-nutrient agar plates lawned with Escherichia coli and incubated at room temperature. The presence of Acanthamoeba was conf i rmed after 14 days of inoculation on the agar medium by observation of trophozoites and cysts using an inverted microscope. The morphological characteristics of both stages were observed as a trophozoite stage which comprises of a motile cell with prominent vacuole having acanthopodia with a diameter between 13 and 23 μm while a cyst stage consists of a triangular dormant double walled structure with a diameter between 12.0 and 22.5 μm. Axenic culture of Acanthamoeba was obtained. To yield the monogenous culture of Acanthamoeba， sub-cultures were routinely performed three to four times in the laboratory prior to DNA extraction of this pathogen.

2.3. Identification of Acanthamoeba using PCR

The feeding trophozoites were harvested using cold Page’s Saline，（0.12 g NaCl， 0.004 g MgSO4.7H2O， 0.004 g CaCl2.2H2O， 0.142 g Na2HPO4， and 0.136 g KH2PO4per liter of distilled water）， and centrifuged at 3 500 rpm for 10 min， followed by DNA extraction using QIamp DNA blood mini kit （QIAGEN， Hiden， Germany）. Polymerase chain reaction was performed in a 25 μL mixture of distilled water， 10X DNA polymerase buffer （Thermo Scientific，Lithuania ， USA）， 25 mM of magnesium chloride （MgCl2）（Thermo Scientific， Lithuania， USA）， 10 mM of deoxynucleotide triphosphate （dNTP） mix （Thermo Scientific， Lithuania， USA），200 moles of each of Acanthamoeba genus-specific primer［14］: JDP1 （5’- GGCCCAGATCGTTACCGTGAA -3’） and JDP2（5’- TCTCACAAGCTGCTAGGGAGTCA-3’）， 1U of Taq DNA polymerase （Thermo Scientif i c， Lithuania， USA） and 5 μL of DNA template. The reaction was carried out at 94 ℃ for 5 min， followed by 40 cycles of annealing at 94 ℃ for 1 min， 60 ℃ for 1 min， 72 ℃for 1 min， and an extension at 72 ℃ for 5 min. For negative control，the DNA template was replaced with the same volume of sterile distilled water.

2.5. Molecular analysis

PCR amplif i cations were carried out by targeting the 18S region and the amplicon at 450 bp was analyzed using 1.5% electrophoresisgel. The gel was stained with ethidium bromide and visualized under UV light. The positive samples were sent for sequencing and homology search was performed by BLAST software， obtained from National Centre for Biotechnology Information.

2.6. In vitro cultivation of trophozoite and cyst stages

Environmental isolates of A. triangularis were cultured on NNA plates coated with Escherichia coli at 26 ℃. Trophozoites at the exponential growth phase between 24 and 48 h were gently scrapped from the base of NNA culture plates with a sterile cell scraper. The trophozoites were washed twice with sterile Pages’s Saline and were concentrated by centrifugation at 1 500 g for 5 min［15］. The number of viable trophozoites was determined by 0.4% trypan blue exclusion and direct trophozoites count on hemocytometer［16，17］. The fi nal concentration was adjusted to 100 000 trophozoites/mL and the trophozoites were used in the assay without delay. Two-three week old culture of A. triangularis was used in cysticidal assay. The cysts were harvested by washing in Page’s Saline and were adjusted to a fi nal concentration of 100 000 cysts/mL， as previously described. The viability of cysts was tested by 0.4% trypan blue method， and the inoculum with 100% viability was used in the experiment to see the ef f ects of L. japonica Thunb. extracts on cysts.

2.7. Amoebicidal activity testing

Two hundred microliters of calibrated trophozoites or cysts suspensions and 200 μL of ethyl acetate， butanol or water fraction（0.5 mg/mL， 1.0 mg/mL and 1.5 mg/mL） of L. japonica Thunb. were mixed thoroughly in micro-centrifuge tubes and kept at 26 ℃in the dark for 24， 48 and 72 h. Control tubes contain only sterile distilled water instead of plant extracts with 200 μL of trophozoites/ cysts suspension. Chlorhexidine was used as a positive control at a concentration of 4 μg and 25 μg in 1 mL of sterile distilled water for trophozoites and cysts respectively［18，19］. After 24， 48 and 72 h of incubation at 26 ℃， 10 μL of trophozoites or cysts suspension was mixed with 10 μL of 0.4% trypan blue in a counting chamber. The specimens were incubated for 3 min at room temperature and the unstained （viable） and stained （nonviable） trophozoites were counted separately in hemocytometer［19］.

2.8. Encystment assay

A. triangularis was divided into five experimental groups， each comprising 100 000 trophozoites/mL. The fi rst group was treated with 100 μL of chlorogenic acid （Sigma Aldrich， St. Louis， USA）at a concentration of 1 mg/mL with 100 μL （10 000 trophozoites）of trophozoites suspension for 3 days. The second group was treated with 0.6% hydrogen peroxide for 3 days （10 μL of 6% H2O2mixed with 90 μL of sterile distilled water） to 100 μL of trophozoites suspension. The third group was treated concomitantly with chlorogenic acid （1 mg/mL） and hydrogen peroxide （10 μL of 6% H2O2mixed with 90 μL of sterile distilled water） to 100 μL of trophozoites suspension for 3 dsys. The fourth group was treated with chlorogenic acid （Sigma Aldrich， St. Louis， USA）at a concentration of 1 mg/mL for a day and then concomitantly hydrogen peroxide （10 μL of 6% H2O2mixed with 90 μL of sterile distilled water） to 100 μL of trophozoites suspension for 2 days. The fi fth group served as a control and treated with sterile distilled water and trophozoites suspension for 3 days. Each day， 10 μL of test solutions were pipetted out and mixed with 10 μL of 0.4% trypan blue and cells （trophozoites and cysts） were counted using hemocytometer.

2.9. Statistical analysis

The data analysis was performed by using SPSS software（Statistical Package for Social Sciences） version 21 （SPSS， Chicago，IL， USA）. Data were presented as mean values with standard deviations and were analyzed by repeated measure of ANOVA followed by the Tukey test for the post hoc pairwise comparisons. P＜ 0.05 was regarded as statistical signif i cance.

3. Results

3.1. Ethyl acetate， water and butanol fraction of L. japonica inhibit the growth of A. triangularis in vitro

In vitro amoebicidal effects were examined by evaluating the percentage of growth inhibition of ethyl acetate， water and butanol fraction of L. japonica in comparison with the untreated as a control. The positive standard chlorhexidine at a dose of 4 μg/mL reduced trophozoites availability by 57.9%， 71.4% and 71.5% in comparison with non-treated control after 24， 48 and 72 h， respectively. The ethyl acetate fraction at a concentration of 1.5 mg/mL evoked a signif i cant reduction （P＜0.05） of trophozoites viability by 48.9% after 24 h，49.2% after 48 h and 33.7% after 72 h as compared to the nontreated （control）， as shown in Table 1.

Upon administration of the aqueous fraction at a concentrationof 1.5 mg/mL， the survival of trophozoites showed a significant reduction （P＜0.05） by 25.0%， 12.8% and 44.7% in comparison with control after 24， 48 and 72 h， respectively， as demonstrated in Table 2.

Whereas， the butanol fraction at a concentration of 1.5 mg/mL，reduced the viability by 20.2% and 2.30% in comparison with control after 24 and 48 h， as shown in Table 3.

Overall， the results obtained from the in vitro assay on trophozoites demonstrate that the viability of trophozoites challenged with the ethyl acetate and aqueous fractions were significantly inhibited compared to control group. However， ethyl acetate， butanol， water fractions of L. japonica Thunb. and chlorhexidine did not show any signif i cant growth inhibition against the resistant cystic stage （Figure 1）.

Figure 1. Acanthamoeba triangularis viable cysts.Evaluation on the effect of chlorogenic acid and/or hydrogen peroxide against the encystment of A. triangularis in vitro was shown in Figure 2.

Table 1Ef f ect of L. japonica Thunb. ethyl acetate fraction on growth inhibition/stimulation of Acanthamoeba triangularis.

Table 2Ef f ect of L. japonica Thunb. water fraction on growth inhibition/stimulation of Acanthamoeba triangularis.

Table 3Ef f ect of L. japonica Thunb. butanol fraction on growth inhibition/stimulation of Acanthamoeba triangularis.

Figure2. Ef f ect of chlorogenic acid and/or hydrogen peroxide on encystment of Acanthamoeba triangularis.*P＜0.05， statistically significant difference in comparison between chlorogenic acid and H2O2in same interval. **P＜0.05， statistically signif i cant dif f erence in comparison between chlorogenic acid and post H2O2in same interval.

3.2. Inhibition of encystment by chlorogenic acid

Chlorogenic acid， an ester of caf f eic acid and quinic acid （Figure 2），at a concentration of 1.0 mg/mL， lowered the growth of trophozoites by 100%， 84.0% and 72.3% in comparison with control after 24， 48 and 72 h， respectively.

3.3. Encystment induced by hydrogen peroxide

Following hydrogen peroxide addition to the culture medium， A. triangularis encysted with a ratio cysts/trophozoites increased by of 65.1%， 66. 3% and 60.9% after 24， 48 and 72 h， respectively as compared to control.

Figure 3. Chemical structure of chlorogenic acid.

3.4. Effect of chlorogenic acid on encystment induced by hydrogen peroxide

Concurrent administration of chlorogenic acid at a concentration of 1 mg/mL and 0.6% hydrogen peroxide sustained cysts/trophozoites ratio as 0.333， 0.333， 0.333 after 24， 48 and 72 h respectively. Initially cysts/trophozoites ratio increased by 30.1% after 24 h and a reduction by 33.4% and 81.5% after 48 and 72 h respectively in comparison to the control.

3.5. Prophylactic effect of chlorogenic acid on encystment induced by hydrogen peroxide

A. triangularis trophozoites were exposed to chlorogenic acid at a concentration of 1 mg/mL for 48 h and challenged with hydrogen peroxide. After 24 hours， the ratio cysts/trophozoites was decreased by 34.3%. After exposure to hydrogen peroxide after 48 and 72 h， the ratio cysts/trophozoites were increased by 4.0% and 38.8% respectively as compared to the control.

4. Discussion

Acanthamoeba encephalitis is a life threatening condition in immunocompromised patients for which current therapeutic agents have severe side effects. More often Acanthamoeba accounts for keratitis and/or conjunctivitis resulting in keratoconjunctivitis or blindness. Treatment of Acanthamoeba keratitis is difficult and requires topical application of drugs for several months， representing a major constrain for the patients because of lack of drugs to target both trophozoites and cysts.

As part of an ongoing study to isolate chemopreventive or therapeutic compounds from Asian medicinal plants， we became interested in the fl ower buds of L. japonica Thunb. or ‘Jin Yin Hua’which are used for the treatment of acute conjunctivitis in traditional Chinese medicine［21］. The ethyl acetate fraction at concentrations ranging from 0.5 mg/mL to 1.5 mg/mL， after 72 h， dose dependently inhibited the growth of trophozoites and exhibited levels of potency superior to 0.004% chlorhexidine which is used for the treatment of Acanthamoeba keratitis［22］. In extreme temperature， desiccation，osmolarity and pH conditions， there is a phenotypic shift of Acanthamoeba from trophozoites into a round， doubled-walled cysts which allow the protozoa to remain alive for years in harsh environment. The duration of the viability of Acanthamoeba cysts is about 25 years in the natural environment with well-maintained invasive properties［23］.

In this context， we examined the cystocidal ef f ects of the 3 fractions obtained from the flower buds of L. japonica Thunb. The ethyl acetate fraction at 0.5 mg/mL evoked a non-signif i cant decrease number of cysts by 26.3% after 72 h and this ef f ect was superior to 0.025% chlorhexidine. Similarly， the aqueous fraction evoked a 29.6% reduction of cysts after 24 h at 1.5 mg/mL. The butanol at 1.5 mg/mL was comparatively least reactive and showed 11.6% ofdecrement of cysts viability after 24 h in comparison with control. Emergence of resistance to biocides during differentiation of Acanthamoeba castellanii has been reported［24］. Cysts are diffi cult to eradicate， giving rise to the concept that agents inhibiting encystment of Acanthamoeba could facilitate the treatment of acanthamoebiasis. So far， we know that glycogen stores in Acanthamoeba serve as a source of glucose for the synthesis of cellulose during encystment. In fact， glycogen is the most rapidly degraded macromolecule during the early hours of encystment via increased enzymatic activity of glycogen phosphorylase［25］. In mammalian cells， glycogen phosphorylase is activated by adenosine monophosphate activated protein kinase which is allosterically activated by cellular starvation and reactive oxygen species［26］. In fact， evidence suggests that the generation of reactive oxygen species， coupled to redox cycling，driven by cytoplasmic and mitochondrial processes， are the core of observed rhythmicity and scale-free dynamics of Acanthamoeba［27］. In our study， none of the tested fractions was signif i cantly active since the double walled structure of Acanthamoeba cysts made of protein and cellulose resists most chemotherapeutic agents. We further examined the effects of chlorogenic acid， against A. triangularis encystment induced by reactive oxygen species. Chlorogenic acid， the fi rst isolated was from cof f ee beans［28］ is the major active component of the flowers of L. japonica Thunb［29］. Current encystment techniques employ axenic and xenic techniques which are based on bacterial deprivation and osmotic stress respectively and hydrogen peroxide was used in this study as an oxidative cystogenic agent. Upon exposure of A. triangularis trophozoites to hydrogen peroxide in culture media， a signif i cant increase in cysts/trophozoites ratio after 72 h occurred and coadministration of chlorogenic acid at a concentration of 1 mg/mL repressed the ratio by approximately 90% after 72 h. In addition， we examined the ef f ect of chlorogenic acid pre-treatment on hydrogenperoxide encystment and found a reduction of cysts/trophozoites by about 60%. The precise mechanism underlying the anti-encystment ef f ect of chlorogenic acid is， at this point， unknown. This phenolic compound is anti-inf l ammatory［30］ and antioxidant［31］ and accounts for most of the medicinal uses of the plant［32］. Resveratrol and demethoxycurcumin which are strong antioxidants have been recently reported to inhibit the growth of Acanthamoeba in vitro［33］and this is important because it raises the possibility that antioxidant principles may be able to inhibit encystment of Acanthamoeba. Thus，although highly speculative， since chlorogenic acid scavenges free radicals in vitro with an IC50equal to 10.2 μM［34］， it is reasonable to speculate that this ester of caf f eic acid and quinic acid inhibits encystment by scavenging reactive oxygen species in the cytoplasm of Acanthamoeba impeding thus downstream allosteric activation of adenosine monophosphate activated protein kinase and downstream glycogen phosphatase.

From the results obtained in this study， the flower buds of L. japonica being abundantly available in Asia may represent a source of lead for the treatment. Alternatively， chlorogenic acid shows as a promising candidate for the combined therapy for acanthamoebiasis with existing therapeutic agents. Therefore， this could be the major breakthrough not only for more future studies to explore more of its potential for not only Acanthamoeba but also other waterborne protozoan parasites. In addition， this could also serve as a potential alternative medicine for pathogenic Acanthamoeba causing keratitis in the future.

Conflict of interest statement

We declare that we have no conf l icts of interest.

Acknowledgments

This study was supported by Fundamental Research Grant Scheme（FRGS/1/2014/SG01/UNIM/02/1）， Ministry of Higher Education Malaysia and University of Malaya Research Grant （UMRG 544/14HTM and UMRG 362-15AFR）.

［1］ Visvesvara GS. Free-living pathogenic amoebae. Lennette EH， Hausler WJ， Truant JP， editors. Manual of clinical microbiology， 3rd ed. Washington， DC: American Society for Microbiology； 1980. p. 704-708.

［2］ Marciano-Cabral F， Cabral G. Acanthamoeba spp. as agents of disease in humans. Clin Microbiol Rev 200； 16（2）: 273-307.

［3］ Khan NA. Acanthamoeba and the blood-brain barrier: the breakthrough. Med Microbiol 2008； 57: 1051-1057.

［4］ Khan NA. Pathogenesis of Acanthamoeba infections. Microb Pathog 2003；34: 277-285.

［5］ Neff RJ， Ray SA ， Benton WF， Wilborn M. Methods in cell physiology. Prescott DM， editor. New York: Academic Press； 1964. p. 55-83.

［6］ Loyd D. Encystment in Acanthamoeba castellanii: A review. Exp Parasitol 2014； 145: S20-S27.

［7］ Pussard M， Pons R. Morphology of cystic wall and taxonomy of genus Acanthamoeba （Protozoa， Amoebida）. Protistologica 1977； 13（4）: 557-598.

［8］ Xuan YH， Chung BS， Hong YC， Kong HH， Hahn TW， Chung DI. Keratitisby Acanthamoeba triangularis: report of cases and characterization of isolates. Korean J Parasitol 2008； 46（3）: 157-164.

［9］ Malatyali E， Tepe B， Degerli S， Berk S. In vitro amoebicidal activities of Satureja cuneifolia and Melissa officinalis on Acanthamoeba castellanii cysts and trophozoites. Parasitol Res 2012； 110: 2175-2180.

［10］ Ródio C， da Rocha Vianna D， Kowalski KP， Panatieri LF， von Poser G，Rott MB. In vitro evaluation of the amebicidal activity of Pterocaulon polystachyum （Asteraceae） against trophozoites of Acanthamoeba castellanii. Parasitol Res 2008； 104: 191-194.

［11］ Dorman HJ， Bachmayer O， Kosar M， Hiltunen R. Antioxidant properties of aqueous extracts from selected lamiaceae species grown in Turkey. J Agric Food Chem 2004； 52（4）: 762-770.

［12］ Pereira RP， Fachinetto R ， de Souza Prestes A， Puntel RL， Santos da Silva GN， Heinzmann BM， et al. Antioxidant ef f ects of dif f erent extracts from Melissa officinalis， Matricaria recutita and Cymbopogon citratus. Neurochem Res 2009； 34: 973-983.

［13］ Shang X， Pan H， Li M ， Miao X， Ding H. Lonicera japonica Thunb.: ethnopharmacology， phytochemistry and pharmacology of an important traditional Chinese medicine. J Ethnopharmacol 2012； 138: 1-21.

［14］ Schroeder JM ， Booton GC ， Hay J， Niszl IA ， Seal DV ， Markus MB，et al. Use of subgenic 18S ribosomal DNA PCR and sequencing for genus and genotyping identif i cation of Acanthamoeba from humans with keratitis and from sewage sludge. J Clin Microbiol 2001； 9: 1930.

［15］ Garcia LS， Brucker DA. Diagnostic medical parasitology. 2nd ed. Washington: ASM Press 1993； p. 601.

［16］ Khan NA. Acanthamoeba: biology and pathogenesis. Norfolk UK: Caister Academic Press 2009； p. 85.

［17］ Auran JD， Starr MB， Jakobiec FA. Acanthamoeba keratitis. A review of the literature. Cornea 1987； 6: 2-26.

［18］ Nakisah MA ， Ida Muryany MY， Fatimah H， Nor Fadilah R ， Zalilawati MR， Khamsa S， et al. Anti-amoebic properties of a Malaysian marine sponge Aaptos sp. on Acanthamoeba castellanii. World J Microbiol Biotechnol 2012； 28（3）: 1237-1244.

［19］ Narasimhan S， Madhavan HN， Therese KL. Development and application of an in vitro susceptibility test for Acanthamoeba species isolated from keratitis to polyhexamethylene biguanide and chlorhexidine. Cornea 2002； 21（2）: 203-205.

［20］ Tepe B， Malatyali E， Degerli S， Berk S. In vitro amoebicidal activities of Teucrium polium and T. chamaedrys on Acanthamoeba castellanii trophozoites and cysts. Parasitol Res 2012； 110（5）: 1773-1778.

［21］ Zhu YP. Chinese materia medica: chemistry， pharmacology and applications. CRC Press， 1998.

［22］ Velpandian T， editor. Pharmacology of ocular therapeutics. Springer 2016.

［23］ Mazur T， Hada? E， Iwanicka I. The duration of the cyst stage and the viability and virulence of Acanthamoeba isolates. Trop Med Parasitol 1995； 46（2）: 106-108.

［24］ Turner NA， Russell AD， Furr JR， Lloyd D. Emergence of resistance to biocides during dif f erentiation of Acanthamoeba castellanii. J Antimicrob chemother 2000； 46（1）: 27-34.

［25］ Lorenzo-Morales J， Kliescikova J， Martinez-Carretero E， De Pablos LM， Profotova B， Nohynkova E， et al. Glycogen phosphorylase in Acanthamoeba spp.: determining the role of the enzyme during the encystment process using RNA interference. Eukaryot Cell 2008； 7: 509-517.

［26］ Liu GS， Chan EC， Higuchi M， Dusting GJ， Jiang F. Redox mechanisms in regulation of adipocyte differentiation: beyond a general stress response. Cells 2012； 1: 976-993.

［27］ Khunkitti W， Lloyd D， Furr JR， Russell AD. Acanthamoeba castellanii: growth， encystment， excystment and biocide susceptibility. J Infect 1998；36: 43-48.

［28］ Hulme AC. The isolation of chlorogenic acid from the apple fruit. Biochem J 1953； 53: 337-340.

［29］ Huo XF， Tang YP， Zhang QL， Luo SH. Ef f ect of chlorogenic acid on the macrophages induced by lipopolysaccharide. Acta Academiae Medicinae Zunyi 2003； 26: 507-508.

［30］ Shan J， Fu J， Zhao Z， Kong X， Huang H， Luo L， et al. Chlorogenic acid inhibits lipopolysaccharide-induced cyclooxygenase-2 expression in RAW264. 7 cells through suppressing NF-κB and JNK/AP-1 activation. Int immunopharmacol 2009； 9（9）: 1042-1048.

［31］ Sato Y， Itagaki S ， Kurokawa T， Ogura J， Kobayashi M， Hirano T， et al. In vitro and in vivo antioxidant properties of chlorogenic acid and caf f eic acid. Int J Pharm 2011； 403（1）: 136-138.

［32］ Wiart C. Medicinal plants of the Asia-Pacific: Drugs for the future？Singapore: World Scientif i c Publishing Co Pte Ltd； 2006， p. 603-605.

［33］ Aqeel Y， Iqbal J， Siddiqui R， Gilani AH， Khan NA. Anti-acanthamoebic properties of resveratrol and demethoxycurcumin. Exp Parasitol 2012；132（4）: 519-523.

［34］ Kim SS， Lee CK， Kang SS， Jung HA， Choi JS. Chlorogenic acid， an antioxidant principle from the aerial parts of Artemisia iwayomogi that acts on 1，1-diphenyl-2-picrylhydrazyl radical. Arch Pharm Res 1997； 20: 148-154.

10.1016/j.apjtm.2016.07.008

Tooba Mahboob， Department of Parasitology， Faculty of Medicine，University of Malaya， 50603 Kuala Lumpur， Malaysia.

E-mail: tooba666@hotmail.com

?Corresponding author: Veeranoot Nissapatorn， Faculty of Medicine， University of Malaya， 50603 Kuala Lumpur.

Tel: +603-79676618

Fax: +603-79674754

E-mail: veeranoot@um.edu.my

Foundation project: This study was supported by Fundamental Research Grant Scheme （FRGS/1/2014/SG01/UNIM/02/1）， Ministry of Higher Education Malaysia and University of Malaya Research Grant （UMRG 544/14HTM and UMRG 362-15AFR）.